Incidental Mutation 'R5860:Tet1'
ID453855
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Nametet methylcytosine dioxygenase 1
SynonymsBB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5860 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62804570-62908996 bp(-) (GRCm38)
Type of Mutationunclassified (2 bp from exon)
DNA Base Change (assembly) A to G at 62812620 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174121] [ENSMUST00000174189]
Predicted Effect probably benign
Transcript: ENSMUST00000050826
AA Change: V1979A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: V1979A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173087
SMART Domains Protein: ENSMUSP00000133706
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Tet_JBP 2 138 2.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173905
SMART Domains Protein: ENSMUSP00000134571
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Pfam:Tet_JBP 1 61 2.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174121
SMART Domains Protein: ENSMUSP00000134328
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Tet_JBP 1 352 1.49e-83 SMART
low complexity region 365 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174189
AA Change: V2011A

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: V2011A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0166:Tet1 UTSW 10 62840279 missense probably benign 0.05
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 unclassified probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1016:Tet1 UTSW 10 62879950 missense probably benign
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R2962:Tet1 UTSW 10 62814544 nonsense probably null
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62838848 missense probably damaging 0.97
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5465:Tet1 UTSW 10 62839777 missense probably benign
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5763:Tet1 UTSW 10 62840068 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
R7472:Tet1 UTSW 10 62813350 missense possibly damaging 0.84
R7507:Tet1 UTSW 10 62832892 critical splice donor site probably null
R7522:Tet1 UTSW 10 62818983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACGTCGGAGTTGAAATGGGC -3'
(R):5'- ATAGCACCCATTCACGGCTC -3'

Sequencing Primer
(F):5'- ATGACTTTCTTTTTAACAGCACCGG -3'
(R):5'- TCGGAAGGAGCTTCATGC -3'
Posted On2017-02-10