Incidental Mutation 'R5860:Cthrc1'
ID453866
Institutional Source Beutler Lab
Gene Symbol Cthrc1
Ensembl Gene ENSMUSG00000054196
Gene Namecollagen triple helix repeat containing 1
Synonyms1110014B07Rik
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5860 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39076932-39087121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39086685 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 146 (C146R)
Ref Sequence ENSEMBL: ENSMUSP00000153886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022908] [ENSMUST00000067072] [ENSMUST00000226433]
Predicted Effect probably benign
Transcript: ENSMUST00000022908
SMART Domains Protein: ENSMUSP00000022908
Gene: ENSMUSG00000022299

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Mito_carr 20 113 4.5e-24 PFAM
Pfam:Mito_carr 116 214 1e-24 PFAM
Pfam:Mito_carr 220 311 3.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067072
AA Change: C220R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070018
Gene: ENSMUSG00000054196
AA Change: C220R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144800
Predicted Effect probably damaging
Transcript: ENSMUST00000226433
AA Change: C146R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9535 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Adult mice homozygous for a null allele exhibit decreased bone, decreased osteoblast number and decreased bone formation. Mice homozygous for a different knock-out allele exhibit increased hepatocyte size, decreased cell density in the liver, hepatic steatosis and increased glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Cthrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cthrc1 APN 15 39080499 missense possibly damaging 0.95
IGL02532:Cthrc1 APN 15 39077165 splice site probably benign
IGL02954:Cthrc1 APN 15 39076994 utr 5 prime probably benign
IGL03390:Cthrc1 APN 15 39077134 missense probably benign 0.00
R0390:Cthrc1 UTSW 15 39086764 makesense probably null
R0594:Cthrc1 UTSW 15 39077142 missense possibly damaging 0.95
R1491:Cthrc1 UTSW 15 39086677 missense probably damaging 1.00
R4454:Cthrc1 UTSW 15 39077013 missense probably benign 0.18
R5096:Cthrc1 UTSW 15 39084420 missense probably damaging 0.99
R7082:Cthrc1 UTSW 15 39077100 missense probably benign
R7717:Cthrc1 UTSW 15 39077116 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAATCATGGAAATGCCTCC -3'
(R):5'- CATTCAGCTGAGCACTTCATTTAAG -3'

Sequencing Primer
(F):5'- GGAAATGCCTCCAAAAATGTCTGTG -3'
(R):5'- ACTGAAATCGTCAGAGGC -3'
Posted On2017-02-10