Incidental Mutation 'R5860:Zftraf1'
ID 453867
Institutional Source Beutler Lab
Gene Symbol Zftraf1
Ensembl Gene ENSMUSG00000053929
Gene Name zinc finger TRAF type containing 1
Synonyms Cyhr1, Chrp, 1110031M01Rik
MMRRC Submission 044072-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.322) question?
Stock # R5860 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76527586-76541120 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76532391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 239 (I239N)
Ref Sequence ENSEMBL: ENSMUSP00000155816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081291] [ENSMUST00000176274] [ENSMUST00000229524]
AlphaFold Q9QXA1
Predicted Effect possibly damaging
Transcript: ENSMUST00000081291
AA Change: I151N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929
AA Change: I151N

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176274
AA Change: I239N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134739
Gene: ENSMUSG00000053929
AA Change: I239N

DomainStartEndE-ValueType
low complexity region 3 48 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
RING 106 150 1.9e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229524
AA Change: I239N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229552
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,524,661 (GRCm39) noncoding transcript Het
A2ml1 T C 6: 128,518,024 (GRCm39) T1421A probably benign Het
Actr8 T A 14: 29,708,242 (GRCm39) Y150* probably null Het
Adamts1 A G 16: 85,595,432 (GRCm39) C249R probably damaging Het
Adgre1 T A 17: 57,752,034 (GRCm39) I594N probably damaging Het
Atf6 A T 1: 170,669,344 (GRCm39) L119H probably damaging Het
Atf6 G A 1: 170,669,345 (GRCm39) L119F possibly damaging Het
B3gat2 G A 1: 23,854,400 (GRCm39) W33* probably null Het
Bach2 A G 4: 32,580,268 (GRCm39) D831G probably damaging Het
Ccnk A T 12: 108,153,466 (GRCm39) I76F probably damaging Het
Cdyl A C 13: 36,042,066 (GRCm39) K368T possibly damaging Het
Chi3l1 A G 1: 134,112,909 (GRCm39) T114A probably benign Het
Cnppd1 A G 1: 75,113,131 (GRCm39) V379A probably benign Het
Col11a2 C A 17: 34,283,159 (GRCm39) probably benign Het
Creb3l1 T C 2: 91,854,399 (GRCm39) S18G probably benign Het
Crybg3 A C 16: 59,385,632 (GRCm39) D197E probably damaging Het
Cryga T C 1: 65,142,527 (GRCm39) probably benign Het
Cthrc1 T C 15: 38,950,080 (GRCm39) C146R probably damaging Het
Cyp2c39 A T 19: 39,525,270 (GRCm39) D191V probably damaging Het
Dchs1 C T 7: 105,421,242 (GRCm39) A393T probably damaging Het
Dhx30 G A 9: 109,913,645 (GRCm39) T1126I probably damaging Het
Dock2 C T 11: 34,206,562 (GRCm39) G1345R probably damaging Het
Dsc1 T C 18: 20,228,081 (GRCm39) E425G probably damaging Het
Dynlt2b A G 16: 32,247,614 (GRCm39) Y143C probably damaging Het
Exosc8 C T 3: 54,642,463 (GRCm39) probably benign Het
Fat1 C T 8: 45,504,166 (GRCm39) A4553V probably benign Het
Flnb T A 14: 7,931,135 (GRCm38) L2119Q probably damaging Het
Fnbp4 T A 2: 90,587,826 (GRCm39) D401E probably benign Het
Glyctk T C 9: 106,032,906 (GRCm39) E369G possibly damaging Het
Gm14149 C A 2: 151,066,225 (GRCm39) noncoding transcript Het
Golga4 T C 9: 118,387,174 (GRCm39) L1432P probably damaging Het
Gtpbp4 A T 13: 9,023,196 (GRCm39) S623T probably benign Het
Insc A C 7: 114,390,383 (GRCm39) S85R probably damaging Het
Lgr4 G A 2: 109,821,496 (GRCm39) R126H probably damaging Het
M1ap T A 6: 82,980,795 (GRCm39) L227Q probably damaging Het
Marchf7 T C 2: 60,067,187 (GRCm39) I569T probably damaging Het
Mbd1 C A 18: 74,409,768 (GRCm39) C339* probably null Het
Moxd2 T A 6: 40,857,341 (GRCm39) Y473F probably damaging Het
Mrgpra6 T C 7: 46,839,099 (GRCm39) H2R probably benign Het
Mtus1 T G 8: 41,529,303 (GRCm39) L742F probably damaging Het
Nek11 A G 9: 105,270,160 (GRCm39) Y21H probably benign Het
Notch4 G T 17: 34,801,392 (GRCm39) C1080F probably damaging Het
Nsd3 C A 8: 26,156,107 (GRCm39) P558Q probably damaging Het
Oas1e A T 5: 120,930,015 (GRCm39) S168T probably benign Het
Ogfr T C 2: 180,234,285 (GRCm39) S119P probably damaging Het
Or2y15 A G 11: 49,350,563 (GRCm39) D19G probably damaging Het
Or8g20 T A 9: 39,395,767 (GRCm39) M261L probably benign Het
Pde4dip A G 3: 97,631,504 (GRCm39) I1135T possibly damaging Het
Prex1 G A 2: 166,486,604 (GRCm39) probably benign Het
Ptprf T C 4: 118,068,486 (GRCm39) probably benign Het
Rapsn T C 2: 90,875,859 (GRCm39) V359A probably damaging Het
Ric1 A G 19: 29,577,245 (GRCm39) S1050G possibly damaging Het
Rnft2 A G 5: 118,366,868 (GRCm39) I290T possibly damaging Het
Senp7 C A 16: 55,975,722 (GRCm39) A476E possibly damaging Het
Serpinh1 G A 7: 98,995,571 (GRCm39) S337L probably damaging Het
Slc5a12 C A 2: 110,427,969 (GRCm39) A8D probably benign Het
Smg5 T A 3: 88,250,214 (GRCm39) C109S probably damaging Het
Speer4b T C 5: 27,705,226 (GRCm39) H49R possibly damaging Het
Tas2r109 T C 6: 132,957,664 (GRCm39) I89V probably benign Het
Tet1 A G 10: 62,648,399 (GRCm39) probably null Het
Tmed6 G T 8: 107,790,786 (GRCm39) T87K probably damaging Het
Tpgs1 G A 10: 79,505,545 (GRCm39) G101D probably damaging Het
Trim13 T G 14: 61,842,188 (GRCm39) S68R probably damaging Het
Vwf A G 6: 125,620,053 (GRCm39) N1577S Het
Vwf G T 6: 125,656,228 (GRCm39) probably benign Het
Xpr1 T C 1: 155,207,868 (GRCm39) probably benign Het
Ylpm1 C T 12: 85,087,660 (GRCm39) P1148L probably damaging Het
Zscan29 G T 2: 120,994,518 (GRCm39) T489N probably damaging Het
Other mutations in Zftraf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zftraf1 APN 15 76,530,738 (GRCm39) missense probably damaging 1.00
IGL03163:Zftraf1 APN 15 76,543,474 (GRCm39) missense probably damaging 0.97
R0107:Zftraf1 UTSW 15 76,530,547 (GRCm39) missense possibly damaging 0.90
R0445:Zftraf1 UTSW 15 76,532,457 (GRCm39) missense probably damaging 1.00
R0759:Zftraf1 UTSW 15 76,530,385 (GRCm39) makesense probably null
R1327:Zftraf1 UTSW 15 76,533,376 (GRCm39) missense probably damaging 0.98
R1366:Zftraf1 UTSW 15 76,533,169 (GRCm39) missense probably damaging 0.96
R1950:Zftraf1 UTSW 15 76,543,417 (GRCm39) critical splice donor site probably null
R3416:Zftraf1 UTSW 15 76,542,915 (GRCm39) splice site probably null
R5092:Zftraf1 UTSW 15 76,530,512 (GRCm39) missense probably benign 0.11
R5749:Zftraf1 UTSW 15 76,542,844 (GRCm39) splice site probably null
R5860:Zftraf1 UTSW 15 76,540,615 (GRCm39) missense probably damaging 1.00
R6032:Zftraf1 UTSW 15 76,543,058 (GRCm39) missense probably damaging 0.99
R6032:Zftraf1 UTSW 15 76,543,058 (GRCm39) missense probably damaging 0.99
R6397:Zftraf1 UTSW 15 76,532,391 (GRCm39) missense probably damaging 1.00
R6481:Zftraf1 UTSW 15 76,542,908 (GRCm39) splice site probably null
R6533:Zftraf1 UTSW 15 76,531,930 (GRCm39) nonsense probably null
R7466:Zftraf1 UTSW 15 76,532,386 (GRCm39) missense probably benign 0.29
R7484:Zftraf1 UTSW 15 76,530,435 (GRCm39) missense probably damaging 1.00
R7629:Zftraf1 UTSW 15 76,532,386 (GRCm39) missense probably benign 0.29
R7732:Zftraf1 UTSW 15 76,532,386 (GRCm39) missense probably benign 0.29
R7763:Zftraf1 UTSW 15 76,542,747 (GRCm39) missense probably damaging 0.99
R7861:Zftraf1 UTSW 15 76,532,386 (GRCm39) missense probably benign 0.29
R9300:Zftraf1 UTSW 15 76,530,541 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGAGCCATGCAGGTACATC -3'
(R):5'- ATGACCGTTTGTTCCAGCCAC -3'

Sequencing Primer
(F):5'- ACTGCCCAGAGCCTACTG -3'
(R):5'- GTTCCAGCCACAGAGTTGATC -3'
Posted On 2017-02-10