Incidental Mutation 'R5860:Cyhr1'
ID453867
Institutional Source Beutler Lab
Gene Symbol Cyhr1
Ensembl Gene ENSMUSG00000053929
Gene Namecysteine and histidine rich 1
Synonyms1110031M01Rik, Chrp
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R5860 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76643395-76660117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76648191 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 239 (I239N)
Ref Sequence ENSEMBL: ENSMUSP00000155816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081291] [ENSMUST00000176274] [ENSMUST00000229524]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081291
AA Change: I151N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929
AA Change: I151N

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176274
AA Change: I239N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134739
Gene: ENSMUSG00000053929
AA Change: I239N

DomainStartEndE-ValueType
low complexity region 3 48 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
RING 106 150 1.9e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229524
AA Change: I239N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229552
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Cyhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cyhr1 APN 15 76646538 missense probably damaging 1.00
IGL03163:Cyhr1 APN 15 76659274 missense probably damaging 0.97
R0107:Cyhr1 UTSW 15 76646347 missense possibly damaging 0.90
R0445:Cyhr1 UTSW 15 76648257 missense probably damaging 1.00
R0759:Cyhr1 UTSW 15 76646185 makesense probably null
R1327:Cyhr1 UTSW 15 76649176 missense probably damaging 0.98
R1366:Cyhr1 UTSW 15 76648969 missense probably damaging 0.96
R1950:Cyhr1 UTSW 15 76659217 critical splice donor site probably null
R3416:Cyhr1 UTSW 15 76658715 unclassified probably null
R5092:Cyhr1 UTSW 15 76646312 missense probably benign 0.11
R5749:Cyhr1 UTSW 15 76658644 intron probably null
R5860:Cyhr1 UTSW 15 76656415 missense probably damaging 1.00
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6397:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R6481:Cyhr1 UTSW 15 76658708 intron probably null
R6533:Cyhr1 UTSW 15 76647730 nonsense probably null
R7466:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7484:Cyhr1 UTSW 15 76646235 missense probably damaging 1.00
R7629:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7732:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7763:Cyhr1 UTSW 15 76658547 missense probably damaging 0.99
R7861:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7944:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGGAGCCATGCAGGTACATC -3'
(R):5'- ATGACCGTTTGTTCCAGCCAC -3'

Sequencing Primer
(F):5'- ACTGCCCAGAGCCTACTG -3'
(R):5'- GTTCCAGCCACAGAGTTGATC -3'
Posted On2017-02-10