Mutagenetix > Incidental Mutations

Incidental Mutation 'R5860:Notch4'

453874

Institutional Source

Beutler Lab

Gene Symbol

Notch4

Ensembl Gene

ENSMUSG00000015468

Gene Name

notch 4

Synonyms

Int3, N4, Int-3

MMRRC Submission

044072-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5860 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

34564268-34588503 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 34582418 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 1080 (C1080F)

Ref Sequence

ENSEMBL: ENSMUSP00000015612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015612
AA Change: C1080F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: C1080F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	24	60	3.2e-4	SMART
EGF	64	112	1.07e-5	SMART
EGF	118	152	5.49e-3	SMART
EGF	156	189	9.33e-6	SMART
EGF_CA	191	229	1.42e-10	SMART
EGF	234	271	1.11e-3	SMART
EGF	276	309	1.84e-4	SMART
EGF_CA	311	350	2.52e-11	SMART
EGF_CA	352	388	1.85e-9	SMART
EGF	392	427	1.58e-3	SMART
EGF_CA	429	470	2.46e-14	SMART
EGF_CA	472	508	5.03e-11	SMART
EGF_CA	510	546	6.74e-12	SMART
EGF_CA	548	584	2.98e-13	SMART
EGF_CA	586	622	7.63e-11	SMART
EGF_like	645	686	2.86e1	SMART
EGF	691	724	3.48e-5	SMART
EGF	729	762	3.62e-3	SMART
EGF_CA	764	800	1.48e-8	SMART
EGF	806	839	1.74e-5	SMART
EGF	844	877	2.3e-5	SMART
EGF	881	924	3.59e-7	SMART
EGF_CA	926	962	7.29e-8	SMART
EGF_CA	965	1000	4.42e-7	SMART
EGF_CA	1002	1040	4.56e-9	SMART
EGF	1045	1081	6.16e-6	SMART
EGF	1086	1122	8.65e-1	SMART
EGF	1129	1167	1.45e-2	SMART
NL	1159	1200	6.79e-13	SMART
NL	1203	1242	2.01e-15	SMART
NL	1243	1281	1.85e-14	SMART
NOD	1287	1341	4.37e-8	SMART
NODP	1373	1437	2.12e-6	SMART
transmembrane domain	1441	1463	N/A	INTRINSIC
low complexity region	1525	1539	N/A	INTRINSIC
ANK	1578	1623	2.5e3	SMART
ANK	1628	1657	1.12e-3	SMART
ANK	1661	1691	5.01e-1	SMART
ANK	1695	1724	1.65e-1	SMART
ANK	1728	1757	4.56e-4	SMART
ANK	1761	1790	2.88e-1	SMART
low complexity region	1889	1906	N/A	INTRINSIC
low complexity region	1925	1937	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126702

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141768

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150441

Predicted Effect

probably benign
Transcript: ENSMUST00000151654

Predicted Effect

probably benign
Transcript: ENSMUST00000151867

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156724

Predicted Effect

probably benign
Transcript: ENSMUST00000173389

SMART Domains

Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	28	64	3.2e-4	SMART
EGF	68	116	1.07e-5	SMART
EGF	122	156	5.49e-3	SMART
EGF	160	193	9.33e-6	SMART
EGF_CA	195	233	1.42e-10	SMART
EGF	238	275	1.11e-3	SMART
EGF	280	313	1.84e-4	SMART
EGF_CA	315	354	2.52e-11	SMART
EGF_CA	356	392	1.85e-9	SMART
EGF	396	431	1.58e-3	SMART
EGF_CA	433	474	2.46e-14	SMART
EGF_CA	476	512	5.03e-11	SMART
EGF_CA	514	550	6.74e-12	SMART
EGF_CA	552	588	2.98e-13	SMART
EGF_CA	590	626	7.63e-11	SMART
EGF_like	649	690	2.86e1	SMART
EGF	695	728	3.48e-5	SMART
EGF	733	766	3.62e-3	SMART
EGF_CA	768	804	1.48e-8	SMART
EGF	810	843	1.74e-5	SMART
EGF	848	881	2.3e-5	SMART
EGF	885	928	3.59e-7	SMART
EGF_like	930	955	7.02e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174707

Meta Mutation Damage Score

0.9702

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.8%

Validation Efficiency

97% (75/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568A12Rik	A	G	1: 34,485,580		noncoding transcript	Het
A2ml1	T	C	6: 128,541,061	T1421A	probably benign	Het
Actr8	T	A	14: 29,986,285	Y150*	probably null	Het
Adamts1	A	G	16: 85,798,544	C249R	probably damaging	Het
Adgre1	T	A	17: 57,445,034	I594N	probably damaging	Het
Atf6	A	T	1: 170,841,775	L119H	probably damaging	Het
Atf6	G	A	1: 170,841,776	L119F	possibly damaging	Het
B3gat2	G	A	1: 23,815,319	W33*	probably null	Het
Bach2	A	G	4: 32,580,268	D831G	probably damaging	Het
Ccnk	A	T	12: 108,187,207	I76F	probably damaging	Het
Cdyl	A	C	13: 35,858,083	K368T	possibly damaging	Het
Chil1	A	G	1: 134,185,171	T114A	probably benign	Het
Cnppd1	A	G	1: 75,136,487	V379A	probably benign	Het
Col11a2	C	A	17: 34,064,185		probably benign	Het
Creb3l1	T	C	2: 92,024,054	S18G	probably benign	Het
Crybg3	A	C	16: 59,565,269	D197E	probably damaging	Het
Cryga	T	C	1: 65,103,368		probably benign	Het
Cthrc1	T	C	15: 39,086,685	C146R	probably damaging	Het
Cyhr1	A	T	15: 76,648,191	I239N	probably damaging	Het
Cyhr1	T	C	15: 76,656,415	Y101C	probably damaging	Het
Cyp2c39	A	T	19: 39,536,826	D191V	probably damaging	Het
Dchs1	C	T	7: 105,772,035	A393T	probably damaging	Het
Dhx30	G	A	9: 110,084,577	T1126I	probably damaging	Het
Dock2	C	T	11: 34,256,562	G1345R	probably damaging	Het
Dsc1	T	C	18: 20,095,024	E425G	probably damaging	Het
Exosc8	C	T	3: 54,735,042		probably benign	Het
Fat1	C	T	8: 45,051,129	A4553V	probably benign	Het
Flnb	T	A	14: 7,931,135	L2119Q	probably damaging	Het
Fnbp4	T	A	2: 90,757,482	D401E	probably benign	Het
Glyctk	T	C	9: 106,155,707	E369G	possibly damaging	Het
Gm14149	C	A	2: 151,224,305		noncoding transcript	Het
Golga4	T	C	9: 118,558,106	L1432P	probably damaging	Het
Gtpbp4	A	T	13: 8,973,160	S623T	probably benign	Het
Insc	A	C	7: 114,791,148	S85R	probably damaging	Het
Lgr4	G	A	2: 109,991,151	R126H	probably damaging	Het
M1ap	T	A	6: 83,003,814	L227Q	probably damaging	Het
March7	T	C	2: 60,236,843	I569T	probably damaging	Het
Mbd1	C	A	18: 74,276,697	C339*	probably null	Het
Moxd2	T	A	6: 40,880,407	Y473F	probably damaging	Het
Mrgpra6	T	C	7: 47,189,351	H2R	probably benign	Het
Mtus1	T	G	8: 41,076,266	L742F	probably damaging	Het
Nek11	A	G	9: 105,392,961	Y21H	probably benign	Het
Nsd3	C	A	8: 25,666,091	P558Q	probably damaging	Het
Oas1e	A	T	5: 120,791,950	S168T	probably benign	Het
Ogfr	T	C	2: 180,592,492	S119P	probably damaging	Het
Olfr1387	A	G	11: 49,459,736	D19G	probably damaging	Het
Olfr44	T	A	9: 39,484,471	M261L	probably benign	Het
Pde4dip	A	G	3: 97,724,188	I1135T	possibly damaging	Het
Prex1	G	A	2: 166,644,684		probably benign	Het
Ptprf	T	C	4: 118,211,289		probably benign	Het
Rapsn	T	C	2: 91,045,514	V359A	probably damaging	Het
Ric1	A	G	19: 29,599,845	S1050G	possibly damaging	Het
Rnft2	A	G	5: 118,228,803	I290T	possibly damaging	Het
Senp7	C	A	16: 56,155,359	A476E	possibly damaging	Het
Serpinh1	G	A	7: 99,346,364	S337L	probably damaging	Het
Slc5a12	C	A	2: 110,597,624	A8D	probably benign	Het
Smg5	T	A	3: 88,342,907	C109S	probably damaging	Het
Speer4b	T	C	5: 27,500,228	H49R	possibly damaging	Het
Tas2r109	T	C	6: 132,980,701	I89V	probably benign	Het
Tctex1d2	A	G	16: 32,428,796	Y143C	probably damaging	Het
Tet1	A	G	10: 62,812,620		probably null	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Tpgs1	G	A	10: 79,669,711	G101D	probably damaging	Het
Trim13	T	G	14: 61,604,739	S68R	probably damaging	Het
Vwf	A	G	6: 125,643,090	N1577S		Het
Vwf	G	T	6: 125,679,265		probably benign	Het
Xpr1	T	C	1: 155,332,122		probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Notch4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Notch4	APN	17	34575561	critical splice donor site	probably null
IGL01022:Notch4	APN	17	34565697	missense	probably damaging	1.00
IGL01356:Notch4	APN	17	34581026	missense	possibly damaging	0.67
IGL01634:Notch4	APN	17	34572588	missense	probably damaging	1.00
IGL02150:Notch4	APN	17	34584613	missense	probably damaging	1.00
IGL02248:Notch4	APN	17	34587198	missense	probably damaging	1.00
IGL02271:Notch4	APN	17	34568471	missense	probably damaging	1.00
IGL02299:Notch4	APN	17	34578004	missense	probably damaging	1.00
IGL02561:Notch4	APN	17	34568160	splice site	probably benign
IGL02604:Notch4	APN	17	34565388	splice site	probably null
IGL03323:Notch4	APN	17	34582471	missense	probably damaging	1.00
IGL03366:Notch4	APN	17	34572568	missense	probably damaging	1.00
IGL03408:Notch4	APN	17	34565568	missense	probably benign	0.03
K3955:Notch4	UTSW	17	34568462	missense	probably damaging	1.00
R0123:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0366:Notch4	UTSW	17	34581499	splice site	probably benign
R0446:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0490:Notch4	UTSW	17	34582890	missense	probably damaging	1.00
R0504:Notch4	UTSW	17	34575091	missense	probably damaging	1.00
R0545:Notch4	UTSW	17	34583433	missense	probably damaging	1.00
R0702:Notch4	UTSW	17	34575203	missense	probably damaging	1.00
R0763:Notch4	UTSW	17	34565332	nonsense	probably null
R0854:Notch4	UTSW	17	34568572	missense	probably damaging	1.00
R1082:Notch4	UTSW	17	34587390	missense	probably damaging	1.00
R1196:Notch4	UTSW	17	34568863	missense	probably damaging	1.00
R1316:Notch4	UTSW	17	34567470	missense	probably damaging	1.00
R1493:Notch4	UTSW	17	34567682	nonsense	probably null
R1527:Notch4	UTSW	17	34565744	missense	probably damaging	1.00
R1548:Notch4	UTSW	17	34568422	missense	probably damaging	1.00
R1718:Notch4	UTSW	17	34576763	splice site	probably benign
R1855:Notch4	UTSW	17	34580962	missense	probably benign	0.05
R1988:Notch4	UTSW	17	34587588	missense	possibly damaging	0.59
R2022:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2023:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2078:Notch4	UTSW	17	34568715	critical splice acceptor site	probably null
R2369:Notch4	UTSW	17	34585950	missense	probably benign	0.15
R3846:Notch4	UTSW	17	34578097	missense	probably damaging	1.00
R3874:Notch4	UTSW	17	34578069	nonsense	probably null
R4087:Notch4	UTSW	17	34584435	missense	probably damaging	1.00
R4456:Notch4	UTSW	17	34583833	missense	probably damaging	0.99
R4628:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R4728:Notch4	UTSW	17	34570205	missense	probably benign	0.00
R4778:Notch4	UTSW	17	34582511	missense	possibly damaging	0.95
R4818:Notch4	UTSW	17	34578716	splice site	probably benign
R4828:Notch4	UTSW	17	34570060	missense	probably damaging	1.00
R4830:Notch4	UTSW	17	34570118	missense	probably damaging	1.00
R4859:Notch4	UTSW	17	34587180	missense	probably damaging	1.00
R4871:Notch4	UTSW	17	34577562	missense	possibly damaging	0.63
R5090:Notch4	UTSW	17	34580920	missense	probably damaging	0.99
R5290:Notch4	UTSW	17	34565289	missense	probably benign	0.01
R5363:Notch4	UTSW	17	34587123	missense	probably damaging	1.00
R6352:Notch4	UTSW	17	34567461	missense	probably damaging	1.00
R6385:Notch4	UTSW	17	34573814	missense	probably null	0.16
R6422:Notch4	UTSW	17	34584559	missense	probably benign
R6645:Notch4	UTSW	17	34587816	missense	probably benign	0.00
R6836:Notch4	UTSW	17	34586100	missense	probably damaging	0.96
R6943:Notch4	UTSW	17	34583603	missense	probably benign
R6991:Notch4	UTSW	17	34584800	nonsense	probably null
R7078:Notch4	UTSW	17	34582546	missense	possibly damaging	0.94
R7168:Notch4	UTSW	17	34572693	missense	probably benign	0.05
R7182:Notch4	UTSW	17	34583499	missense	probably damaging	1.00
R7240:Notch4	UTSW	17	34576471	missense	probably benign	0.00
R7247:Notch4	UTSW	17	34572517	missense	probably damaging	1.00
R7556:Notch4	UTSW	17	34575470	missense	probably damaging	1.00
R7571:Notch4	UTSW	17	34583574	missense	probably damaging	0.99
R7697:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R7763:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R7994:Notch4	UTSW	17	34578090	missense	possibly damaging	0.82
R8139:Notch4	UTSW	17	34584800	nonsense	probably null
R8171:Notch4	UTSW	17	34582509	nonsense	probably null
R8375:Notch4	UTSW	17	34568254	missense	possibly damaging	0.90
R8448:Notch4	UTSW	17	34586789	splice site	probably null
R8543:Notch4	UTSW	17	34568420	missense	probably damaging	1.00
R8776:Notch4	UTSW	17	34587605	missense	probably damaging	1.00
R8776-TAIL:Notch4	UTSW	17	34587605	missense	probably damaging	1.00
X0054:Notch4	UTSW	17	34584495	missense	probably damaging	1.00
X0067:Notch4	UTSW	17	34586084	nonsense	probably null
Z1088:Notch4	UTSW	17	34587915	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34575148	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34587908	missense	probably damaging	0.97
Z1177:Notch4	UTSW	17	34587909	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TAAGCCAGTGTGCGCAGTTAG -3'
(R):5'- TGCATTGAAAGCCCGGGTTG -3'

Sequencing Primer
(F):5'- TGCGCAGTTAGCAGGGGAC -3'
(R):5'- CTCAGTGCAGGTACCATTGTGC -3'

Posted On

2017-02-10