Mutagenetix > Incidental Mutation

Incidental Mutation 'R5860:Adgre1'

453875

Institutional Source

Beutler Lab

Gene Symbol

Adgre1

Ensembl Gene

ENSMUSG00000004730

Gene Name

adhesion G protein-coupled receptor E1

Synonyms

Emr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71

MMRRC Submission

044072-MU

Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene?

Possibly non essential (E-score: 0.359) question?

Stock #

R5860 (G1)

Quality Score

189

Status

Validated

Chromosome

Chromosomal Location

57358686-57483529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57445034 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 594 (I594N)

Ref Sequence

ENSEMBL: ENSMUSP00000083971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]

AlphaFold

Q61549

Predicted Effect

probably damaging
Transcript: ENSMUST00000004850
AA Change: I594N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: I594N

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086763
AA Change: I594N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: I594N

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Meta Mutation Damage Score

0.4430

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.8%

Validation Efficiency

97% (75/77)

MGI Phenotype

Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568A12Rik	A	G	1: 34,485,580		noncoding transcript	Het
A2ml1	T	C	6: 128,541,061	T1421A	probably benign	Het
Actr8	T	A	14: 29,986,285	Y150*	probably null	Het
Adamts1	A	G	16: 85,798,544	C249R	probably damaging	Het
Atf6	A	T	1: 170,841,775	L119H	probably damaging	Het
Atf6	G	A	1: 170,841,776	L119F	possibly damaging	Het
B3gat2	G	A	1: 23,815,319	W33*	probably null	Het
Bach2	A	G	4: 32,580,268	D831G	probably damaging	Het
Ccnk	A	T	12: 108,187,207	I76F	probably damaging	Het
Cdyl	A	C	13: 35,858,083	K368T	possibly damaging	Het
Chil1	A	G	1: 134,185,171	T114A	probably benign	Het
Cnppd1	A	G	1: 75,136,487	V379A	probably benign	Het
Col11a2	C	A	17: 34,064,185		probably benign	Het
Creb3l1	T	C	2: 92,024,054	S18G	probably benign	Het
Crybg3	A	C	16: 59,565,269	D197E	probably damaging	Het
Cryga	T	C	1: 65,103,368		probably benign	Het
Cthrc1	T	C	15: 39,086,685	C146R	probably damaging	Het
Cyhr1	A	T	15: 76,648,191	I239N	probably damaging	Het
Cyhr1	T	C	15: 76,656,415	Y101C	probably damaging	Het
Cyp2c39	A	T	19: 39,536,826	D191V	probably damaging	Het
Dchs1	C	T	7: 105,772,035	A393T	probably damaging	Het
Dhx30	G	A	9: 110,084,577	T1126I	probably damaging	Het
Dock2	C	T	11: 34,256,562	G1345R	probably damaging	Het
Dsc1	T	C	18: 20,095,024	E425G	probably damaging	Het
Exosc8	C	T	3: 54,735,042		probably benign	Het
Fat1	C	T	8: 45,051,129	A4553V	probably benign	Het
Flnb	T	A	14: 7,931,135	L2119Q	probably damaging	Het
Fnbp4	T	A	2: 90,757,482	D401E	probably benign	Het
Glyctk	T	C	9: 106,155,707	E369G	possibly damaging	Het
Gm14149	C	A	2: 151,224,305		noncoding transcript	Het
Golga4	T	C	9: 118,558,106	L1432P	probably damaging	Het
Gtpbp4	A	T	13: 8,973,160	S623T	probably benign	Het
Insc	A	C	7: 114,791,148	S85R	probably damaging	Het
Lgr4	G	A	2: 109,991,151	R126H	probably damaging	Het
M1ap	T	A	6: 83,003,814	L227Q	probably damaging	Het
March7	T	C	2: 60,236,843	I569T	probably damaging	Het
Mbd1	C	A	18: 74,276,697	C339*	probably null	Het
Moxd2	T	A	6: 40,880,407	Y473F	probably damaging	Het
Mrgpra6	T	C	7: 47,189,351	H2R	probably benign	Het
Mtus1	T	G	8: 41,076,266	L742F	probably damaging	Het
Nek11	A	G	9: 105,392,961	Y21H	probably benign	Het
Notch4	G	T	17: 34,582,418	C1080F	probably damaging	Het
Nsd3	C	A	8: 25,666,091	P558Q	probably damaging	Het
Oas1e	A	T	5: 120,791,950	S168T	probably benign	Het
Ogfr	T	C	2: 180,592,492	S119P	probably damaging	Het
Olfr1387	A	G	11: 49,459,736	D19G	probably damaging	Het
Olfr44	T	A	9: 39,484,471	M261L	probably benign	Het
Pde4dip	A	G	3: 97,724,188	I1135T	possibly damaging	Het
Prex1	G	A	2: 166,644,684		probably benign	Het
Ptprf	T	C	4: 118,211,289		probably benign	Het
Rapsn	T	C	2: 91,045,514	V359A	probably damaging	Het
Ric1	A	G	19: 29,599,845	S1050G	possibly damaging	Het
Rnft2	A	G	5: 118,228,803	I290T	possibly damaging	Het
Senp7	C	A	16: 56,155,359	A476E	possibly damaging	Het
Serpinh1	G	A	7: 99,346,364	S337L	probably damaging	Het
Slc5a12	C	A	2: 110,597,624	A8D	probably benign	Het
Smg5	T	A	3: 88,342,907	C109S	probably damaging	Het
Speer4b	T	C	5: 27,500,228	H49R	possibly damaging	Het
Tas2r109	T	C	6: 132,980,701	I89V	probably benign	Het
Tctex1d2	A	G	16: 32,428,796	Y143C	probably damaging	Het
Tet1	A	G	10: 62,812,620		probably null	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Tpgs1	G	A	10: 79,669,711	G101D	probably damaging	Het
Trim13	T	G	14: 61,604,739	S68R	probably damaging	Het
Vwf	A	G	6: 125,643,090	N1577S		Het
Vwf	G	T	6: 125,679,265		probably benign	Het
Xpr1	T	C	1: 155,332,122		probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Adgre1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Adgre1	APN	17	57450055	missense	probably benign	0.00
IGL00966:Adgre1	APN	17	57419335	missense	probably benign	0.04
IGL01680:Adgre1	APN	17	57402620	missense	unknown
IGL01724:Adgre1	APN	17	57444064	nonsense	probably null
IGL02172:Adgre1	APN	17	57478879	missense	probably damaging	1.00
IGL02260:Adgre1	APN	17	57447891	missense	probably benign	0.01
IGL02272:Adgre1	APN	17	57450021	nonsense	probably null
IGL02336:Adgre1	APN	17	57411024	nonsense	probably null
IGL02346:Adgre1	APN	17	57443919	missense	probably benign	0.15
IGL02398:Adgre1	APN	17	57402824	nonsense	probably null
IGL02618:Adgre1	APN	17	57444021	missense	possibly damaging	0.66
IGL02690:Adgre1	APN	17	57480921	missense	probably damaging	1.00
IGL02936:Adgre1	APN	17	57478833	missense	probably benign	0.26
IGL03112:Adgre1	APN	17	57448029	splice site	probably null
IGL03350:Adgre1	APN	17	57401908	missense	probably benign	0.16
F480	UTSW	17	57444063	missense	probably damaging	1.00
lomax	UTSW	17	57402811	missense	unknown
Onion	UTSW	17	57402841	nonsense	probably null
Scallion	UTSW	17	57401977	missense	possibly damaging	0.90
R0049:Adgre1	UTSW	17	57402841	nonsense	probably null
R0153:Adgre1	UTSW	17	57443939	missense	possibly damaging	0.92
R0277:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0278:Adgre1	UTSW	17	57447872	missense	probably benign	0.07
R0323:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0389:Adgre1	UTSW	17	57406839	missense	possibly damaging	0.80
R0492:Adgre1	UTSW	17	57402742	missense	unknown
R0621:Adgre1	UTSW	17	57441359	missense	probably damaging	0.98
R0647:Adgre1	UTSW	17	57411003	missense	probably damaging	1.00
R1310:Adgre1	UTSW	17	57447936	missense	probably benign	0.00
R1601:Adgre1	UTSW	17	57441353	missense	probably benign	0.01
R1689:Adgre1	UTSW	17	57449921	missense	probably benign	0.31
R1708:Adgre1	UTSW	17	57401974	missense	possibly damaging	0.93
R1796:Adgre1	UTSW	17	57441350	missense	probably benign	0.43
R1839:Adgre1	UTSW	17	57441299	missense	probably benign	0.00
R1860:Adgre1	UTSW	17	57441363	missense	probably benign	0.00
R2165:Adgre1	UTSW	17	57419338	missense	probably damaging	0.97
R2219:Adgre1	UTSW	17	57401912	missense	possibly damaging	0.92
R2519:Adgre1	UTSW	17	57410956	missense	probably damaging	1.00
R3874:Adgre1	UTSW	17	57401925	missense	probably benign	0.08
R3911:Adgre1	UTSW	17	57447860	missense	probably damaging	1.00
R4190:Adgre1	UTSW	17	57402811	missense	unknown
R4439:Adgre1	UTSW	17	57447954	missense	probably damaging	1.00
R4513:Adgre1	UTSW	17	57410947	missense	probably benign	0.34
R4529:Adgre1	UTSW	17	57420519	missense	possibly damaging	0.92
R4543:Adgre1	UTSW	17	57406874	missense	probably benign	0.07
R4610:Adgre1	UTSW	17	57450073	missense	possibly damaging	0.50
R4665:Adgre1	UTSW	17	57480947	missense	probably benign	0.20
R4911:Adgre1	UTSW	17	57447832	missense	possibly damaging	0.57
R4928:Adgre1	UTSW	17	57444064	nonsense	probably null
R4942:Adgre1	UTSW	17	57406903	missense	probably damaging	1.00
R4946:Adgre1	UTSW	17	57443918	missense	probably benign	0.33
R4953:Adgre1	UTSW	17	57441321	missense	probably damaging	0.99
R5107:Adgre1	UTSW	17	57401977	missense	possibly damaging	0.90
R5366:Adgre1	UTSW	17	57402817	missense	probably benign	0.39
R5590:Adgre1	UTSW	17	57445034	missense	probably damaging	1.00
R5619:Adgre1	UTSW	17	57420437	missense	probably benign	0.15
R5699:Adgre1	UTSW	17	57481007	missense	probably benign	0.43
R5734:Adgre1	UTSW	17	57443990	missense	probably benign	0.00
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6149:Adgre1	UTSW	17	57445018	missense	probably benign	0.08
R6478:Adgre1	UTSW	17	57401955	missense	possibly damaging	0.81
R6709:Adgre1	UTSW	17	57406917	missense	probably benign	0.10
R6864:Adgre1	UTSW	17	57478879	missense	probably damaging	1.00
R6945:Adgre1	UTSW	17	57410844	missense	probably benign	0.01
R6945:Adgre1	UTSW	17	57420399	missense	probably benign	0.39
R6988:Adgre1	UTSW	17	57408445	missense	probably benign	0.00
R7019:Adgre1	UTSW	17	57410945	missense	probably damaging	0.98
R7154:Adgre1	UTSW	17	57444087	splice site	probably null
R7347:Adgre1	UTSW	17	57420441	missense	probably damaging	1.00
R7459:Adgre1	UTSW	17	57449933	missense	probably damaging	1.00
R7709:Adgre1	UTSW	17	57402519	missense	unknown
R7939:Adgre1	UTSW	17	57449938	missense	probably damaging	0.98
R7977:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R7987:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R8187:Adgre1	UTSW	17	57420349	missense	probably benign	0.00
R8210:Adgre1	UTSW	17	57445061	missense	possibly damaging	0.94
R8223:Adgre1	UTSW	17	57361692	missense	probably damaging	0.99
R8344:Adgre1	UTSW	17	57408459	missense	probably benign	0.12
R8698:Adgre1	UTSW	17	57402003	missense	probably benign	0.05
R9236:Adgre1	UTSW	17	57402782	nonsense	probably null
R9262:Adgre1	UTSW	17	57447941	missense	probably damaging	1.00
R9303:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
R9305:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
Z1176:Adgre1	UTSW	17	57361729	missense	possibly damaging	0.76
Z1177:Adgre1	UTSW	17	57419374	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTAGTCCGACACCAGATCAAGC -3'
(R):5'- AGACACAAGATGGTCTGCC -3'

Sequencing Primer
(F):5'- CACCACTACAGACTAGAATACAGTAG -3'
(R):5'- CTAGGTTTTAGGCAAGATACTCAGG -3'

Posted On

2017-02-10