Incidental Mutation 'R5860:Mbd1'
ID453877
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Namemethyl-CpG binding domain protein 1
SynonymsPCM1, Cxxc3
MMRRC Submission 044072-MU
Accession Numbers

NCBI RefSeq: NM_013594.2; MGI:1333811

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5860 (G1)
Quality Score207
Status Validated
Chromosome18
Chromosomal Location74267605-74282732 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 74276697 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 339 (C339*)
Ref Sequence ENSEMBL: ENSMUSP00000153085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
Predicted Effect probably null
Transcript: ENSMUST00000097530
AA Change: C449*
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561
AA Change: C449*

DomainStartEndE-ValueType
MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224047
AA Change: C505*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224159
Predicted Effect probably null
Transcript: ENSMUST00000224332
AA Change: C339*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype Strain: 2664084
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Exosc8 C T 3: 54,735,042 probably benign Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74275239 missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74269543 unclassified probably benign
IGL02213:Mbd1 APN 18 74275382 missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74276922 missense probably benign 0.00
IGL02596:Mbd1 APN 18 74276797 splice site probably benign
IGL02944:Mbd1 APN 18 74277410 missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74275427 splice site probably benign
IGL03200:Mbd1 APN 18 74276431 missense probably benign 0.02
IGL03247:Mbd1 APN 18 74274754 nonsense probably null
IGL03340:Mbd1 APN 18 74274482 missense probably benign 0.00
FR4737:Mbd1 UTSW 18 74273573 small deletion probably benign
P0016:Mbd1 UTSW 18 74274538 nonsense probably null
R0385:Mbd1 UTSW 18 74273241 frame shift probably null
R0630:Mbd1 UTSW 18 74276727 splice site probably benign
R0717:Mbd1 UTSW 18 74273597 missense possibly damaging 0.89
R1084:Mbd1 UTSW 18 74269532 missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74269486 missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74275419 critical splice donor site probably null
R2065:Mbd1 UTSW 18 74276884 missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74277378 missense probably damaging 0.99
R2308:Mbd1 UTSW 18 74276477 missense probably benign 0.42
R2697:Mbd1 UTSW 18 74273617 missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74277367 missense possibly damaging 0.94
R4348:Mbd1 UTSW 18 74274416 missense probably damaging 1.00
R4664:Mbd1 UTSW 18 74269526 missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74269510 missense probably benign 0.03
R6431:Mbd1 UTSW 18 74273691 intron probably null
R6734:Mbd1 UTSW 18 74276043 missense probably damaging 1.00
R6861:Mbd1 UTSW 18 74273574
R7363:Mbd1 UTSW 18 74273286 missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74274449 missense probably damaging 0.97
R7657:Mbd1 UTSW 18 74274733 missense probably damaging 0.99
R7871:Mbd1 UTSW 18 74274057 critical splice donor site probably null
R7954:Mbd1 UTSW 18 74274057 critical splice donor site probably null
RF005:Mbd1 UTSW 18 74273573 small deletion probably benign
RF011:Mbd1 UTSW 18 74273610 small deletion probably benign
RF024:Mbd1 UTSW 18 74273573 small deletion probably benign
RF024:Mbd1 UTSW 18 74273610 small deletion probably benign
RF058:Mbd1 UTSW 18 74273609 frame shift probably null
Z1177:Mbd1 UTSW 18 74276939 missense probably null 0.72
Predicted Primers PCR Primer
(F):5'- CTGAGCTCTCCCTTAAAGGC -3'
(R):5'- CCCAAACCTTGCTAGGGAAG -3'

Sequencing Primer
(F):5'- CCCTTAAAGGCCCCTTGG -3'
(R):5'- AAGGTCGTGACTGCTGTCCAC -3'
Posted On2017-02-10