Mutagenetix > Incidental Mutations

Incidental Mutation 'R5860:Ric1'

453878

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

044072-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R5860 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29599845 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1050 (S1050G)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043610
AA Change: S1050G

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: S1050G

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160452
AA Change: Q162R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000125299
Gene: ENSMUSG00000038658
AA Change: Q162R

Domain	Start	End	E-Value	Type
Pfam:RIC1	8	163	1.4e-60	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000161330
AA Change: S71G

SMART Domains

Protein: ENSMUSP00000125709
Gene: ENSMUSG00000038658
AA Change: S71G

Domain	Start	End	E-Value	Type
low complexity region	7	28	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161536

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: S941G

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: S941G

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.1%
20x: 90.8%

Validation Efficiency

97% (75/77)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568A12Rik	A	G	1: 34,485,580		noncoding transcript	Het
A2ml1	T	C	6: 128,541,061	T1421A	probably benign	Het
Actr8	T	A	14: 29,986,285	Y150*	probably null	Het
Adamts1	A	G	16: 85,798,544	C249R	probably damaging	Het
Adgre1	T	A	17: 57,445,034	I594N	probably damaging	Het
Atf6	A	T	1: 170,841,775	L119H	probably damaging	Het
Atf6	G	A	1: 170,841,776	L119F	possibly damaging	Het
B3gat2	G	A	1: 23,815,319	W33*	probably null	Het
Bach2	A	G	4: 32,580,268	D831G	probably damaging	Het
Ccnk	A	T	12: 108,187,207	I76F	probably damaging	Het
Cdyl	A	C	13: 35,858,083	K368T	possibly damaging	Het
Chil1	A	G	1: 134,185,171	T114A	probably benign	Het
Cnppd1	A	G	1: 75,136,487	V379A	probably benign	Het
Col11a2	C	A	17: 34,064,185		probably benign	Het
Creb3l1	T	C	2: 92,024,054	S18G	probably benign	Het
Crybg3	A	C	16: 59,565,269	D197E	probably damaging	Het
Cryga	T	C	1: 65,103,368		probably benign	Het
Cthrc1	T	C	15: 39,086,685	C146R	probably damaging	Het
Cyhr1	A	T	15: 76,648,191	I239N	probably damaging	Het
Cyhr1	T	C	15: 76,656,415	Y101C	probably damaging	Het
Cyp2c39	A	T	19: 39,536,826	D191V	probably damaging	Het
Dchs1	C	T	7: 105,772,035	A393T	probably damaging	Het
Dhx30	G	A	9: 110,084,577	T1126I	probably damaging	Het
Dock2	C	T	11: 34,256,562	G1345R	probably damaging	Het
Dsc1	T	C	18: 20,095,024	E425G	probably damaging	Het
Exosc8	C	T	3: 54,735,042		probably benign	Het
Fat1	C	T	8: 45,051,129	A4553V	probably benign	Het
Flnb	T	A	14: 7,931,135	L2119Q	probably damaging	Het
Fnbp4	T	A	2: 90,757,482	D401E	probably benign	Het
Glyctk	T	C	9: 106,155,707	E369G	possibly damaging	Het
Gm14149	C	A	2: 151,224,305		noncoding transcript	Het
Golga4	T	C	9: 118,558,106	L1432P	probably damaging	Het
Gtpbp4	A	T	13: 8,973,160	S623T	probably benign	Het
Insc	A	C	7: 114,791,148	S85R	probably damaging	Het
Lgr4	G	A	2: 109,991,151	R126H	probably damaging	Het
M1ap	T	A	6: 83,003,814	L227Q	probably damaging	Het
March7	T	C	2: 60,236,843	I569T	probably damaging	Het
Mbd1	C	A	18: 74,276,697	C339*	probably null	Het
Moxd2	T	A	6: 40,880,407	Y473F	probably damaging	Het
Mrgpra6	T	C	7: 47,189,351	H2R	probably benign	Het
Mtus1	T	G	8: 41,076,266	L742F	probably damaging	Het
Nek11	A	G	9: 105,392,961	Y21H	probably benign	Het
Notch4	G	T	17: 34,582,418	C1080F	probably damaging	Het
Nsd3	C	A	8: 25,666,091	P558Q	probably damaging	Het
Oas1e	A	T	5: 120,791,950	S168T	probably benign	Het
Ogfr	T	C	2: 180,592,492	S119P	probably damaging	Het
Olfr1387	A	G	11: 49,459,736	D19G	probably damaging	Het
Olfr44	T	A	9: 39,484,471	M261L	probably benign	Het
Pde4dip	A	G	3: 97,724,188	I1135T	possibly damaging	Het
Prex1	G	A	2: 166,644,684		probably benign	Het
Ptprf	T	C	4: 118,211,289		probably benign	Het
Rapsn	T	C	2: 91,045,514	V359A	probably damaging	Het
Rnft2	A	G	5: 118,228,803	I290T	possibly damaging	Het
Senp7	C	A	16: 56,155,359	A476E	possibly damaging	Het
Serpinh1	G	A	7: 99,346,364	S337L	probably damaging	Het
Slc5a12	C	A	2: 110,597,624	A8D	probably benign	Het
Smg5	T	A	3: 88,342,907	C109S	probably damaging	Het
Speer4b	T	C	5: 27,500,228	H49R	possibly damaging	Het
Tas2r109	T	C	6: 132,980,701	I89V	probably benign	Het
Tctex1d2	A	G	16: 32,428,796	Y143C	probably damaging	Het
Tet1	A	G	10: 62,812,620		probably null	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Tpgs1	G	A	10: 79,669,711	G101D	probably damaging	Het
Trim13	T	G	14: 61,604,739	S68R	probably damaging	Het
Vwf	A	G	6: 125,643,090	N1577S		Het
Vwf	G	T	6: 125,679,265		probably benign	Het
Xpr1	T	C	1: 155,332,122		probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7941:Ric1	UTSW	19	29533259	missense	probably damaging	1.00
R8115:Ric1	UTSW	19	29586573	missense	probably damaging	1.00
R8117:Ric1	UTSW	19	29574791	missense	probably benign	0.08
R8477:Ric1	UTSW	19	29597783	missense	probably damaging	1.00
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGCTGCATGTTTACTAGGC -3'
(R):5'- GGCCACAGGAAATCCTTGTG -3'

Sequencing Primer
(F):5'- CTGCATGTTTACTAGGCTGTGG -3'
(R):5'- GTCTCTTCAGGGCTACTACAAAG -3'

Posted On

2017-02-10