Incidental Mutation 'R5861:Olfr1141'
ID453884
Institutional Source Beutler Lab
Gene Symbol Olfr1141
Ensembl Gene ENSMUSG00000075148
Gene Nameolfactory receptor 1141
SynonymsMOR177-10, GA_x6K02T2Q125-49257818-49256883
MMRRC Submission 044073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5861 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87753056-87753991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87753578 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 138 (N138K)
Ref Sequence ENSEMBL: ENSMUSP00000097433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099846]
Predicted Effect probably benign
Transcript: ENSMUST00000099846
AA Change: N138K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097433
Gene: ENSMUSG00000075148
AA Change: N138K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-28 PFAM
Pfam:7tm_1 41 290 1.5e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,298,812 D143G probably damaging Het
Abcc5 G T 16: 20,399,894 T246N probably damaging Het
Arhgap10 C T 8: 77,310,764 A612T probably damaging Het
Arsg T A 11: 109,563,188 F407I probably damaging Het
Asxl1 C A 2: 153,399,390 A620D probably damaging Het
BC080695 G T 4: 143,571,240 V77L probably benign Het
C2cd3 A G 7: 100,444,475 probably benign Het
Chn2 G A 6: 54,290,374 V92I probably damaging Het
Cog2 T C 8: 124,537,878 F332S probably damaging Het
Crhbp G A 13: 95,443,825 A82V probably damaging Het
Cyp2j6 A G 4: 96,545,803 V90A possibly damaging Het
Dennd4c A T 4: 86,791,352 M397L probably benign Het
Dnajb8 A G 6: 88,223,106 D208G possibly damaging Het
Ecm1 G C 3: 95,736,597 L230V probably damaging Het
Ercc2 G C 7: 19,394,141 A696P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm13035 A G 4: 146,073,289 noncoding transcript Het
Gm28042 T C 2: 120,034,635 V247A probably damaging Het
Gm28455 T A 7: 39,498,579 noncoding transcript Het
Gpr150 A T 13: 76,056,073 V251D possibly damaging Het
Grip1 C T 10: 119,929,970 S69L probably damaging Het
Hs6st3 A G 14: 119,138,853 I147V possibly damaging Het
Il5 G A 11: 53,723,916 E102K probably benign Het
Kif1c T C 11: 70,703,795 F94L probably damaging Het
Lrrc63 T C 14: 75,107,366 E427G possibly damaging Het
Man1b1 A G 2: 25,348,054 T384A probably benign Het
Mapk15 C A 15: 75,996,359 probably benign Het
Mfsd10 T C 5: 34,634,244 probably benign Het
Mgat5 C A 1: 127,387,392 A285E probably damaging Het
Mroh4 T A 15: 74,606,607 probably benign Het
Myf5 A T 10: 107,484,208 C194S probably benign Het
Myh7 A G 14: 54,988,890 V431A possibly damaging Het
Nadsyn1 A C 7: 143,811,227 M247R possibly damaging Het
Nipsnap3b A G 4: 53,021,177 D166G probably damaging Het
Nqo2 A T 13: 33,972,430 L42F probably damaging Het
Nt5dc3 A T 10: 86,815,874 D180V probably damaging Het
Numa1 C A 7: 102,009,287 probably null Het
Olfm3 T A 3: 115,122,403 L328Q probably damaging Het
Olfr1353 A T 10: 78,969,931 Y94F probably damaging Het
Olfr1508 T C 14: 52,463,496 Y171C probably damaging Het
Papolb T C 5: 142,529,237 N217S possibly damaging Het
Pcmtd2 C A 2: 181,842,475 T26K probably damaging Het
Pld5 T G 1: 176,090,005 N59H probably damaging Het
Ppm1d T C 11: 85,311,848 S126P possibly damaging Het
Ppp1r21 T C 17: 88,582,509 L727P probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rara T A 11: 98,968,161 C148* probably null Het
Rexo2 A T 9: 48,475,181 I83N probably damaging Het
Rnf213 A G 11: 119,473,377 R4501G probably damaging Het
Rps5 T A 7: 12,925,574 F97L probably damaging Het
Sigirr G A 7: 141,091,379 R397W probably damaging Het
Slc6a6 T C 6: 91,741,033 Y318H probably damaging Het
Spam1 A G 6: 24,796,571 T174A probably benign Het
Stam2 G T 2: 52,742,104 probably benign Het
Taar7a T C 10: 23,992,439 E348G probably benign Het
Taf11 T C 17: 27,901,670 T209A probably benign Het
Tenm4 A G 7: 96,843,217 probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Uevld A T 7: 46,926,356 S461T probably benign Het
Vmn2r6 T A 3: 64,556,033 N460I probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zfp316 T C 5: 143,263,340 Y180C unknown Het
Zfp941 A G 7: 140,812,139 S436P probably damaging Het
Zfp979 G A 4: 147,613,509 Q248* probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Olfr1141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1141 APN 2 87753934 missense probably benign 0.00
IGL01412:Olfr1141 APN 2 87753117 missense probably damaging 1.00
IGL01533:Olfr1141 APN 2 87753068 missense probably benign 0.01
IGL02455:Olfr1141 APN 2 87753583 missense possibly damaging 0.95
IGL02698:Olfr1141 APN 2 87753844 nonsense probably null
PIT4480001:Olfr1141 UTSW 2 87753783 missense possibly damaging 0.95
R0543:Olfr1141 UTSW 2 87753650 missense probably damaging 1.00
R1542:Olfr1141 UTSW 2 87753318 missense probably damaging 0.99
R1750:Olfr1141 UTSW 2 87753186 missense probably damaging 0.97
R1844:Olfr1141 UTSW 2 87753990 start codon destroyed probably null 1.00
R2248:Olfr1141 UTSW 2 87753943 missense probably null 0.05
R4064:Olfr1141 UTSW 2 87753789 missense probably damaging 1.00
R5193:Olfr1141 UTSW 2 87753104 missense possibly damaging 0.59
R6146:Olfr1141 UTSW 2 87753258 missense probably damaging 1.00
R6197:Olfr1141 UTSW 2 87753352 missense probably benign 0.15
R6481:Olfr1141 UTSW 2 87753468 missense probably damaging 1.00
R6857:Olfr1141 UTSW 2 87753487 missense probably damaging 1.00
R6904:Olfr1141 UTSW 2 87753879 missense probably benign 0.00
R6962:Olfr1141 UTSW 2 87753727 missense probably benign
R7014:Olfr1141 UTSW 2 87753871 missense probably benign 0.00
R8229:Olfr1141 UTSW 2 87753064 missense probably benign 0.00
T0722:Olfr1141 UTSW 2 87753123 missense probably damaging 1.00
Z1177:Olfr1141 UTSW 2 87753190 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGGACTTCTGAAATAGTGCTC -3'
(R):5'- TGCAATTGGGTCCAAGATGTTG -3'

Sequencing Primer
(F):5'- GGACTTCTGAAATAGTGCTCAACTG -3'
(R):5'- CAATTGGGTCCAAGATGTTGATAGAC -3'
Posted On2017-02-10