Incidental Mutation 'R5861:Cog2'
ID453920
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission 044073-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5861 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124537878 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 332 (F332S)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect probably damaging
Transcript: ENSMUST00000034460
AA Change: F332S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: F332S

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129977
Meta Mutation Damage Score 0.9348 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,298,812 D143G probably damaging Het
Abcc5 G T 16: 20,399,894 T246N probably damaging Het
Arhgap10 C T 8: 77,310,764 A612T probably damaging Het
Arsg T A 11: 109,563,188 F407I probably damaging Het
Asxl1 C A 2: 153,399,390 A620D probably damaging Het
BC080695 G T 4: 143,571,240 V77L probably benign Het
C2cd3 A G 7: 100,444,475 probably benign Het
Chn2 G A 6: 54,290,374 V92I probably damaging Het
Crhbp G A 13: 95,443,825 A82V probably damaging Het
Cyp2j6 A G 4: 96,545,803 V90A possibly damaging Het
Dennd4c A T 4: 86,791,352 M397L probably benign Het
Dnajb8 A G 6: 88,223,106 D208G possibly damaging Het
Ecm1 G C 3: 95,736,597 L230V probably damaging Het
Ercc2 G C 7: 19,394,141 A696P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm13035 A G 4: 146,073,289 noncoding transcript Het
Gm28042 T C 2: 120,034,635 V247A probably damaging Het
Gm28455 T A 7: 39,498,579 noncoding transcript Het
Gpr150 A T 13: 76,056,073 V251D possibly damaging Het
Grip1 C T 10: 119,929,970 S69L probably damaging Het
Hs6st3 A G 14: 119,138,853 I147V possibly damaging Het
Il5 G A 11: 53,723,916 E102K probably benign Het
Kif1c T C 11: 70,703,795 F94L probably damaging Het
Lrrc63 T C 14: 75,107,366 E427G possibly damaging Het
Man1b1 A G 2: 25,348,054 T384A probably benign Het
Mapk15 C A 15: 75,996,359 probably benign Het
Mfsd10 T C 5: 34,634,244 probably benign Het
Mgat5 C A 1: 127,387,392 A285E probably damaging Het
Mroh4 T A 15: 74,606,607 probably benign Het
Myf5 A T 10: 107,484,208 C194S probably benign Het
Myh7 A G 14: 54,988,890 V431A possibly damaging Het
Nadsyn1 A C 7: 143,811,227 M247R possibly damaging Het
Nipsnap3b A G 4: 53,021,177 D166G probably damaging Het
Nqo2 A T 13: 33,972,430 L42F probably damaging Het
Nt5dc3 A T 10: 86,815,874 D180V probably damaging Het
Numa1 C A 7: 102,009,287 probably null Het
Olfm3 T A 3: 115,122,403 L328Q probably damaging Het
Olfr1141 A T 2: 87,753,578 N138K probably benign Het
Olfr1353 A T 10: 78,969,931 Y94F probably damaging Het
Olfr1508 T C 14: 52,463,496 Y171C probably damaging Het
Papolb T C 5: 142,529,237 N217S possibly damaging Het
Pcmtd2 C A 2: 181,842,475 T26K probably damaging Het
Pld5 T G 1: 176,090,005 N59H probably damaging Het
Ppm1d T C 11: 85,311,848 S126P possibly damaging Het
Ppp1r21 T C 17: 88,582,509 L727P probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rara T A 11: 98,968,161 C148* probably null Het
Rexo2 A T 9: 48,475,181 I83N probably damaging Het
Rnf213 A G 11: 119,473,377 R4501G probably damaging Het
Rps5 T A 7: 12,925,574 F97L probably damaging Het
Sigirr G A 7: 141,091,379 R397W probably damaging Het
Slc6a6 T C 6: 91,741,033 Y318H probably damaging Het
Spam1 A G 6: 24,796,571 T174A probably benign Het
Stam2 G T 2: 52,742,104 probably benign Het
Taar7a T C 10: 23,992,439 E348G probably benign Het
Taf11 T C 17: 27,901,670 T209A probably benign Het
Tenm4 A G 7: 96,843,217 probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Uevld A T 7: 46,926,356 S461T probably benign Het
Vmn2r6 T A 3: 64,556,033 N460I probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zfp316 T C 5: 143,263,340 Y180C unknown Het
Zfp941 A G 7: 140,812,139 S436P probably damaging Het
Zfp979 G A 4: 147,613,509 Q248* probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTTTCTCCAGCGAAGAGTTCC -3'
(R):5'- TCATATCCACACTTGAGAGAAGC -3'

Sequencing Primer
(F):5'- GAAGAGTTCCACAACTGGTTCCTG -3'
(R):5'- TATCCACACTTGAGAGAAGCAGTGTG -3'
Posted On2017-02-10