Mutagenetix > Incidental Mutation

Incidental Mutation 'R5861:Cog2'

453920

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

044073-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5861 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124537878 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 332 (F332S)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034460
AA Change: F332S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: F332S

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Meta Mutation Damage Score

0.9348

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.3%
20x: 91.3%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,298,812	D143G	probably damaging	Het
Abcc5	G	T	16: 20,399,894	T246N	probably damaging	Het
Arhgap10	C	T	8: 77,310,764	A612T	probably damaging	Het
Arsg	T	A	11: 109,563,188	F407I	probably damaging	Het
Asxl1	C	A	2: 153,399,390	A620D	probably damaging	Het
BC080695	G	T	4: 143,571,240	V77L	probably benign	Het
C2cd3	A	G	7: 100,444,475		probably benign	Het
Chn2	G	A	6: 54,290,374	V92I	probably damaging	Het
Crhbp	G	A	13: 95,443,825	A82V	probably damaging	Het
Cyp2j6	A	G	4: 96,545,803	V90A	possibly damaging	Het
Dennd4c	A	T	4: 86,791,352	M397L	probably benign	Het
Dnajb8	A	G	6: 88,223,106	D208G	possibly damaging	Het
Ecm1	G	C	3: 95,736,597	L230V	probably damaging	Het
Ercc2	G	C	7: 19,394,141	A696P	possibly damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gm13035	A	G	4: 146,073,289		noncoding transcript	Het
Gm28042	T	C	2: 120,034,635	V247A	probably damaging	Het
Gm28455	T	A	7: 39,498,579		noncoding transcript	Het
Gpr150	A	T	13: 76,056,073	V251D	possibly damaging	Het
Grip1	C	T	10: 119,929,970	S69L	probably damaging	Het
Hs6st3	A	G	14: 119,138,853	I147V	possibly damaging	Het
Il5	G	A	11: 53,723,916	E102K	probably benign	Het
Kif1c	T	C	11: 70,703,795	F94L	probably damaging	Het
Lrrc63	T	C	14: 75,107,366	E427G	possibly damaging	Het
Man1b1	A	G	2: 25,348,054	T384A	probably benign	Het
Mapk15	C	A	15: 75,996,359		probably benign	Het
Mfsd10	T	C	5: 34,634,244		probably benign	Het
Mgat5	C	A	1: 127,387,392	A285E	probably damaging	Het
Mroh4	T	A	15: 74,606,607		probably benign	Het
Myf5	A	T	10: 107,484,208	C194S	probably benign	Het
Myh7	A	G	14: 54,988,890	V431A	possibly damaging	Het
Nadsyn1	A	C	7: 143,811,227	M247R	possibly damaging	Het
Nipsnap3b	A	G	4: 53,021,177	D166G	probably damaging	Het
Nqo2	A	T	13: 33,972,430	L42F	probably damaging	Het
Nt5dc3	A	T	10: 86,815,874	D180V	probably damaging	Het
Numa1	C	A	7: 102,009,287		probably null	Het
Olfm3	T	A	3: 115,122,403	L328Q	probably damaging	Het
Olfr1141	A	T	2: 87,753,578	N138K	probably benign	Het
Olfr1353	A	T	10: 78,969,931	Y94F	probably damaging	Het
Olfr1508	T	C	14: 52,463,496	Y171C	probably damaging	Het
Papolb	T	C	5: 142,529,237	N217S	possibly damaging	Het
Pcmtd2	C	A	2: 181,842,475	T26K	probably damaging	Het
Pld5	T	G	1: 176,090,005	N59H	probably damaging	Het
Ppm1d	T	C	11: 85,311,848	S126P	possibly damaging	Het
Ppp1r21	T	C	17: 88,582,509	L727P	probably damaging	Het
Prpsap2	C	T	11: 61,737,044	R202H	probably damaging	Het
Rara	T	A	11: 98,968,161	C148*	probably null	Het
Rexo2	A	T	9: 48,475,181	I83N	probably damaging	Het
Rnf213	A	G	11: 119,473,377	R4501G	probably damaging	Het
Rps5	T	A	7: 12,925,574	F97L	probably damaging	Het
Sigirr	G	A	7: 141,091,379	R397W	probably damaging	Het
Slc6a6	T	C	6: 91,741,033	Y318H	probably damaging	Het
Spam1	A	G	6: 24,796,571	T174A	probably benign	Het
Stam2	G	T	2: 52,742,104		probably benign	Het
Taar7a	T	C	10: 23,992,439	E348G	probably benign	Het
Taf11	T	C	17: 27,901,670	T209A	probably benign	Het
Tenm4	A	G	7: 96,843,217		probably benign	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Trim5	G	T	7: 104,279,519	H72N	probably benign	Het
Trim5	A	C	7: 104,279,521	L71R	probably benign	Het
Uevld	A	T	7: 46,926,356	S461T	probably benign	Het
Vmn2r6	T	A	3: 64,556,033	N460I	probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zfp316	T	C	5: 143,263,340	Y180C	unknown	Het
Zfp941	A	G	7: 140,812,139	S436P	probably damaging	Het
Zfp979	G	A	4: 147,613,509	Q248*	probably null	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TTTTCTCCAGCGAAGAGTTCC -3'
(R):5'- TCATATCCACACTTGAGAGAAGC -3'

Sequencing Primer
(F):5'- GAAGAGTTCCACAACTGGTTCCTG -3'
(R):5'- TATCCACACTTGAGAGAAGCAGTGTG -3'

Posted On

2017-02-10