Incidental Mutation 'R5861:Taar7a'
ID 453922
Institutional Source Beutler Lab
Gene Symbol Taar7a
Ensembl Gene ENSMUSG00000095647
Gene Name trace amine-associated receptor 7A
Synonyms Taar7a, LOC215856
MMRRC Submission 044073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5861 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 23992405-23993481 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23992439 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 348 (E348G)
Ref Sequence ENSEMBL: ENSMUSP00000077616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078532]
AlphaFold Q5QD12
Predicted Effect probably benign
Transcript: ENSMUST00000078532
AA Change: E348G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077616
Gene: ENSMUSG00000095647
AA Change: E348G

DomainStartEndE-ValueType
Pfam:7tm_4 54 344 9.2e-10 PFAM
Pfam:7TM_GPCR_Srx 56 261 5.2e-9 PFAM
Pfam:7tm_1 64 326 3.2e-58 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,298,812 D143G probably damaging Het
Abcc5 G T 16: 20,399,894 T246N probably damaging Het
Arhgap10 C T 8: 77,310,764 A612T probably damaging Het
Arsg T A 11: 109,563,188 F407I probably damaging Het
Asxl1 C A 2: 153,399,390 A620D probably damaging Het
BC080695 G T 4: 143,571,240 V77L probably benign Het
C2cd3 A G 7: 100,444,475 probably benign Het
Chn2 G A 6: 54,290,374 V92I probably damaging Het
Cog2 T C 8: 124,537,878 F332S probably damaging Het
Crhbp G A 13: 95,443,825 A82V probably damaging Het
Cyp2j6 A G 4: 96,545,803 V90A possibly damaging Het
Dennd4c A T 4: 86,791,352 M397L probably benign Het
Dnajb8 A G 6: 88,223,106 D208G possibly damaging Het
Ecm1 G C 3: 95,736,597 L230V probably damaging Het
Ercc2 G C 7: 19,394,141 A696P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm13035 A G 4: 146,073,289 noncoding transcript Het
Gm28042 T C 2: 120,034,635 V247A probably damaging Het
Gm28455 T A 7: 39,498,579 noncoding transcript Het
Gpr150 A T 13: 76,056,073 V251D possibly damaging Het
Grip1 C T 10: 119,929,970 S69L probably damaging Het
Hs6st3 A G 14: 119,138,853 I147V possibly damaging Het
Il5 G A 11: 53,723,916 E102K probably benign Het
Kif1c T C 11: 70,703,795 F94L probably damaging Het
Lrrc63 T C 14: 75,107,366 E427G possibly damaging Het
Man1b1 A G 2: 25,348,054 T384A probably benign Het
Mapk15 C A 15: 75,996,359 probably benign Het
Mfsd10 T C 5: 34,634,244 probably benign Het
Mgat5 C A 1: 127,387,392 A285E probably damaging Het
Mroh4 T A 15: 74,606,607 probably benign Het
Myf5 A T 10: 107,484,208 C194S probably benign Het
Myh7 A G 14: 54,988,890 V431A possibly damaging Het
Nadsyn1 A C 7: 143,811,227 M247R possibly damaging Het
Nipsnap3b A G 4: 53,021,177 D166G probably damaging Het
Nqo2 A T 13: 33,972,430 L42F probably damaging Het
Nt5dc3 A T 10: 86,815,874 D180V probably damaging Het
Numa1 C A 7: 102,009,287 probably null Het
Olfm3 T A 3: 115,122,403 L328Q probably damaging Het
Olfr1141 A T 2: 87,753,578 N138K probably benign Het
Olfr1353 A T 10: 78,969,931 Y94F probably damaging Het
Olfr1508 T C 14: 52,463,496 Y171C probably damaging Het
Papolb T C 5: 142,529,237 N217S possibly damaging Het
Pcmtd2 C A 2: 181,842,475 T26K probably damaging Het
Pld5 T G 1: 176,090,005 N59H probably damaging Het
Ppm1d T C 11: 85,311,848 S126P possibly damaging Het
Ppp1r21 T C 17: 88,582,509 L727P probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rara T A 11: 98,968,161 C148* probably null Het
Rexo2 A T 9: 48,475,181 I83N probably damaging Het
Rnf213 A G 11: 119,473,377 R4501G probably damaging Het
Rps5 T A 7: 12,925,574 F97L probably damaging Het
Sigirr G A 7: 141,091,379 R397W probably damaging Het
Slc6a6 T C 6: 91,741,033 Y318H probably damaging Het
Spam1 A G 6: 24,796,571 T174A probably benign Het
Stam2 G T 2: 52,742,104 probably benign Het
Taf11 T C 17: 27,901,670 T209A probably benign Het
Tenm4 A G 7: 96,843,217 probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Uevld A T 7: 46,926,356 S461T probably benign Het
Vmn2r6 T A 3: 64,556,033 N460I probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zfp316 T C 5: 143,263,340 Y180C unknown Het
Zfp941 A G 7: 140,812,139 S436P probably damaging Het
Zfp979 G A 4: 147,613,509 Q248* probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Taar7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Taar7a APN 10 23992396 unclassified probably benign
IGL02408:Taar7a APN 10 23992602 missense probably benign
PIT4434001:Taar7a UTSW 10 23993421 missense probably benign
R0422:Taar7a UTSW 10 23993274 missense probably benign 0.02
R1029:Taar7a UTSW 10 23992541 missense possibly damaging 0.65
R1742:Taar7a UTSW 10 23993219 missense probably damaging 0.98
R2104:Taar7a UTSW 10 23993061 missense probably damaging 0.99
R2421:Taar7a UTSW 10 23992517 missense probably damaging 1.00
R3907:Taar7a UTSW 10 23992559 missense probably benign 0.25
R4021:Taar7a UTSW 10 23993386 missense probably benign 0.00
R5180:Taar7a UTSW 10 23993148 missense probably damaging 1.00
R5486:Taar7a UTSW 10 23992458 missense probably benign 0.00
R5507:Taar7a UTSW 10 23992631 missense probably damaging 0.98
R5587:Taar7a UTSW 10 23992828 missense probably benign 0.00
R5766:Taar7a UTSW 10 23993362 missense probably benign 0.01
R7201:Taar7a UTSW 10 23992460 missense probably benign 0.04
R7506:Taar7a UTSW 10 23992994 missense possibly damaging 0.50
R8810:Taar7a UTSW 10 23993381 missense probably benign 0.20
R9015:Taar7a UTSW 10 23992835 missense probably damaging 0.97
R9172:Taar7a UTSW 10 23992779 missense probably benign 0.16
R9686:Taar7a UTSW 10 23993411 missense probably benign 0.01
R9717:Taar7a UTSW 10 23992901 missense probably benign 0.01
R9720:Taar7a UTSW 10 23992835 missense probably benign 0.10
X0064:Taar7a UTSW 10 23992617 missense probably damaging 1.00
Z1177:Taar7a UTSW 10 23992892 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAGCATGAATAGCTGGATTTAC -3'
(R):5'- AAACCCTGGGCATTGCAGTG -3'

Sequencing Primer
(F):5'- TACATGCTTGGATCACAGCTCGAG -3'
(R):5'- ATGGCTGCCATACTTCATTGAC -3'
Posted On 2017-02-10