Incidental Mutation 'R5861:Taar7a'
ID 453922
Institutional Source Beutler Lab
Gene Symbol Taar7a
Ensembl Gene ENSMUSG00000095647
Gene Name trace amine-associated receptor 7A
Synonyms Taar7a, LOC215856
MMRRC Submission 044073-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R5861 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 23868303-23869379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23868337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 348 (E348G)
Ref Sequence ENSEMBL: ENSMUSP00000077616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078532]
AlphaFold Q5QD12
Predicted Effect probably benign
Transcript: ENSMUST00000078532
AA Change: E348G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077616
Gene: ENSMUSG00000095647
AA Change: E348G

DomainStartEndE-ValueType
Pfam:7tm_4 54 344 9.2e-10 PFAM
Pfam:7TM_GPCR_Srx 56 261 5.2e-9 PFAM
Pfam:7tm_1 64 326 3.2e-58 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,218,644 (GRCm39) T246N probably damaging Het
Aopep A G 13: 63,446,626 (GRCm39) D143G probably damaging Het
Arhgap10 C T 8: 78,037,393 (GRCm39) A612T probably damaging Het
Arsg T A 11: 109,454,014 (GRCm39) F407I probably damaging Het
Asxl1 C A 2: 153,241,310 (GRCm39) A620D probably damaging Het
C2cd3 A G 7: 100,093,682 (GRCm39) probably benign Het
Chn2 G A 6: 54,267,359 (GRCm39) V92I probably damaging Het
Cog2 T C 8: 125,264,617 (GRCm39) F332S probably damaging Het
Crhbp G A 13: 95,580,333 (GRCm39) A82V probably damaging Het
Cyp2j6 A G 4: 96,434,040 (GRCm39) V90A possibly damaging Het
Dennd4c A T 4: 86,709,589 (GRCm39) M397L probably benign Het
Dnajb8 A G 6: 88,200,088 (GRCm39) D208G possibly damaging Het
Ecm1 G C 3: 95,643,909 (GRCm39) L230V probably damaging Het
Ercc2 G C 7: 19,128,066 (GRCm39) A696P possibly damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Gm13035 A G 4: 146,009,859 (GRCm39) noncoding transcript Het
Gm28042 T C 2: 119,865,116 (GRCm39) V247A probably damaging Het
Gm28455 T A 7: 39,148,003 (GRCm39) noncoding transcript Het
Gpr150 A T 13: 76,204,192 (GRCm39) V251D possibly damaging Het
Grip1 C T 10: 119,765,875 (GRCm39) S69L probably damaging Het
Hs6st3 A G 14: 119,376,265 (GRCm39) I147V possibly damaging Het
Il5 G A 11: 53,614,743 (GRCm39) E102K probably benign Het
Kif1c T C 11: 70,594,621 (GRCm39) F94L probably damaging Het
Lrrc63 T C 14: 75,344,806 (GRCm39) E427G possibly damaging Het
Man1b1 A G 2: 25,238,066 (GRCm39) T384A probably benign Het
Mapk15 C A 15: 75,868,208 (GRCm39) probably benign Het
Mfsd10 T C 5: 34,791,588 (GRCm39) probably benign Het
Mgat5 C A 1: 127,315,129 (GRCm39) A285E probably damaging Het
Mroh4 T A 15: 74,478,456 (GRCm39) probably benign Het
Myf5 A T 10: 107,320,069 (GRCm39) C194S probably benign Het
Myh7 A G 14: 55,226,347 (GRCm39) V431A possibly damaging Het
Nadsyn1 A C 7: 143,364,964 (GRCm39) M247R possibly damaging Het
Nipsnap3b A G 4: 53,021,177 (GRCm39) D166G probably damaging Het
Nqo2 A T 13: 34,156,413 (GRCm39) L42F probably damaging Het
Nt5dc3 A T 10: 86,651,738 (GRCm39) D180V probably damaging Het
Numa1 C A 7: 101,658,494 (GRCm39) probably null Het
Olfm3 T A 3: 114,916,052 (GRCm39) L328Q probably damaging Het
Or4e1 T C 14: 52,700,953 (GRCm39) Y171C probably damaging Het
Or5w17 A T 2: 87,583,922 (GRCm39) N138K probably benign Het
Or7a37 A T 10: 78,805,765 (GRCm39) Y94F probably damaging Het
Papolb T C 5: 142,514,992 (GRCm39) N217S possibly damaging Het
Pcmtd2 C A 2: 181,484,268 (GRCm39) T26K probably damaging Het
Pld5 T G 1: 175,917,571 (GRCm39) N59H probably damaging Het
Ppm1d T C 11: 85,202,674 (GRCm39) S126P possibly damaging Het
Ppp1r21 T C 17: 88,889,937 (GRCm39) L727P probably damaging Het
Pramel20 G T 4: 143,297,810 (GRCm39) V77L probably benign Het
Prpsap2 C T 11: 61,627,870 (GRCm39) R202H probably damaging Het
Rara T A 11: 98,858,987 (GRCm39) C148* probably null Het
Rexo2 A T 9: 48,386,481 (GRCm39) I83N probably damaging Het
Rnf213 A G 11: 119,364,203 (GRCm39) R4501G probably damaging Het
Rps5 T A 7: 12,659,501 (GRCm39) F97L probably damaging Het
Sigirr G A 7: 140,671,292 (GRCm39) R397W probably damaging Het
Slc6a6 T C 6: 91,718,014 (GRCm39) Y318H probably damaging Het
Spam1 A G 6: 24,796,570 (GRCm39) T174A probably benign Het
Stam2 G T 2: 52,632,116 (GRCm39) probably benign Het
Taf11 T C 17: 28,120,644 (GRCm39) T209A probably benign Het
Tenm4 A G 7: 96,492,424 (GRCm39) probably benign Het
Tmed6 G T 8: 107,790,786 (GRCm39) T87K probably damaging Het
Trim5 G T 7: 103,928,726 (GRCm39) H72N probably benign Het
Trim5 A C 7: 103,928,728 (GRCm39) L71R probably benign Het
Uevld A T 7: 46,576,104 (GRCm39) S461T probably benign Het
Vmn2r6 T A 3: 64,463,454 (GRCm39) N460I probably benign Het
Ylpm1 C T 12: 85,087,660 (GRCm39) P1148L probably damaging Het
Zfp316 T C 5: 143,249,095 (GRCm39) Y180C unknown Het
Zfp941 A G 7: 140,392,052 (GRCm39) S436P probably damaging Het
Zfp979 G A 4: 147,697,966 (GRCm39) Q248* probably null Het
Zscan29 G T 2: 120,994,518 (GRCm39) T489N probably damaging Het
Other mutations in Taar7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Taar7a APN 10 23,868,294 (GRCm39) unclassified probably benign
IGL02408:Taar7a APN 10 23,868,500 (GRCm39) missense probably benign
PIT4434001:Taar7a UTSW 10 23,869,319 (GRCm39) missense probably benign
R0422:Taar7a UTSW 10 23,869,172 (GRCm39) missense probably benign 0.02
R1029:Taar7a UTSW 10 23,868,439 (GRCm39) missense possibly damaging 0.65
R1742:Taar7a UTSW 10 23,869,117 (GRCm39) missense probably damaging 0.98
R2104:Taar7a UTSW 10 23,868,959 (GRCm39) missense probably damaging 0.99
R2421:Taar7a UTSW 10 23,868,415 (GRCm39) missense probably damaging 1.00
R3907:Taar7a UTSW 10 23,868,457 (GRCm39) missense probably benign 0.25
R4021:Taar7a UTSW 10 23,869,284 (GRCm39) missense probably benign 0.00
R5180:Taar7a UTSW 10 23,869,046 (GRCm39) missense probably damaging 1.00
R5486:Taar7a UTSW 10 23,868,356 (GRCm39) missense probably benign 0.00
R5507:Taar7a UTSW 10 23,868,529 (GRCm39) missense probably damaging 0.98
R5587:Taar7a UTSW 10 23,868,726 (GRCm39) missense probably benign 0.00
R5766:Taar7a UTSW 10 23,869,260 (GRCm39) missense probably benign 0.01
R7201:Taar7a UTSW 10 23,868,358 (GRCm39) missense probably benign 0.04
R7506:Taar7a UTSW 10 23,868,892 (GRCm39) missense possibly damaging 0.50
R8810:Taar7a UTSW 10 23,869,279 (GRCm39) missense probably benign 0.20
R9015:Taar7a UTSW 10 23,868,733 (GRCm39) missense probably damaging 0.97
R9172:Taar7a UTSW 10 23,868,677 (GRCm39) missense probably benign 0.16
R9686:Taar7a UTSW 10 23,869,309 (GRCm39) missense probably benign 0.01
R9717:Taar7a UTSW 10 23,868,799 (GRCm39) missense probably benign 0.01
R9720:Taar7a UTSW 10 23,868,733 (GRCm39) missense probably benign 0.10
X0064:Taar7a UTSW 10 23,868,515 (GRCm39) missense probably damaging 1.00
Z1177:Taar7a UTSW 10 23,868,790 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAGCATGAATAGCTGGATTTAC -3'
(R):5'- AAACCCTGGGCATTGCAGTG -3'

Sequencing Primer
(F):5'- TACATGCTTGGATCACAGCTCGAG -3'
(R):5'- ATGGCTGCCATACTTCATTGAC -3'
Posted On 2017-02-10