Incidental Mutation 'R5861:Arsg'
ID453930
Institutional Source Beutler Lab
Gene Symbol Arsg
Ensembl Gene ENSMUSG00000020604
Gene Namearylsulfatase G
Synonyms6330406P08Rik
MMRRC Submission 044073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5861 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109473374-109573330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109563188 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 407 (F407I)
Ref Sequence ENSEMBL: ENSMUSP00000102308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020928] [ENSMUST00000106696] [ENSMUST00000106697]
Predicted Effect probably damaging
Transcript: ENSMUST00000020928
AA Change: F407I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020928
Gene: ENSMUSG00000020604
AA Change: F407I

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 2.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106696
AA Change: F84I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102307
Gene: ENSMUSG00000020604
AA Change: F84I

DomainStartEndE-ValueType
Pfam:Sulfatase 3 55 3.8e-11 PFAM
Pfam:Sulfatase_C 78 199 5.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106697
AA Change: F407I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102308
Gene: ENSMUSG00000020604
AA Change: F407I

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 4.7e-25 PFAM
Meta Mutation Damage Score 0.3737 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null mutation display lysosomal storage pathology in the nervous system and peripheral tissues, including the liver and kidneys, resulting in Purkinje cell loss and age dependent cognitive impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,298,812 D143G probably damaging Het
Abcc5 G T 16: 20,399,894 T246N probably damaging Het
Arhgap10 C T 8: 77,310,764 A612T probably damaging Het
Asxl1 C A 2: 153,399,390 A620D probably damaging Het
BC080695 G T 4: 143,571,240 V77L probably benign Het
C2cd3 A G 7: 100,444,475 probably benign Het
Chn2 G A 6: 54,290,374 V92I probably damaging Het
Cog2 T C 8: 124,537,878 F332S probably damaging Het
Crhbp G A 13: 95,443,825 A82V probably damaging Het
Cyp2j6 A G 4: 96,545,803 V90A possibly damaging Het
Dennd4c A T 4: 86,791,352 M397L probably benign Het
Dnajb8 A G 6: 88,223,106 D208G possibly damaging Het
Ecm1 G C 3: 95,736,597 L230V probably damaging Het
Ercc2 G C 7: 19,394,141 A696P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm13035 A G 4: 146,073,289 noncoding transcript Het
Gm28042 T C 2: 120,034,635 V247A probably damaging Het
Gm28455 T A 7: 39,498,579 noncoding transcript Het
Gpr150 A T 13: 76,056,073 V251D possibly damaging Het
Grip1 C T 10: 119,929,970 S69L probably damaging Het
Hs6st3 A G 14: 119,138,853 I147V possibly damaging Het
Il5 G A 11: 53,723,916 E102K probably benign Het
Kif1c T C 11: 70,703,795 F94L probably damaging Het
Lrrc63 T C 14: 75,107,366 E427G possibly damaging Het
Man1b1 A G 2: 25,348,054 T384A probably benign Het
Mapk15 C A 15: 75,996,359 probably benign Het
Mfsd10 T C 5: 34,634,244 probably benign Het
Mgat5 C A 1: 127,387,392 A285E probably damaging Het
Mroh4 T A 15: 74,606,607 probably benign Het
Myf5 A T 10: 107,484,208 C194S probably benign Het
Myh7 A G 14: 54,988,890 V431A possibly damaging Het
Nadsyn1 A C 7: 143,811,227 M247R possibly damaging Het
Nipsnap3b A G 4: 53,021,177 D166G probably damaging Het
Nqo2 A T 13: 33,972,430 L42F probably damaging Het
Nt5dc3 A T 10: 86,815,874 D180V probably damaging Het
Numa1 C A 7: 102,009,287 probably null Het
Olfm3 T A 3: 115,122,403 L328Q probably damaging Het
Olfr1141 A T 2: 87,753,578 N138K probably benign Het
Olfr1353 A T 10: 78,969,931 Y94F probably damaging Het
Olfr1508 T C 14: 52,463,496 Y171C probably damaging Het
Papolb T C 5: 142,529,237 N217S possibly damaging Het
Pcmtd2 C A 2: 181,842,475 T26K probably damaging Het
Pld5 T G 1: 176,090,005 N59H probably damaging Het
Ppm1d T C 11: 85,311,848 S126P possibly damaging Het
Ppp1r21 T C 17: 88,582,509 L727P probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rara T A 11: 98,968,161 C148* probably null Het
Rexo2 A T 9: 48,475,181 I83N probably damaging Het
Rnf213 A G 11: 119,473,377 R4501G probably damaging Het
Rps5 T A 7: 12,925,574 F97L probably damaging Het
Sigirr G A 7: 141,091,379 R397W probably damaging Het
Slc6a6 T C 6: 91,741,033 Y318H probably damaging Het
Spam1 A G 6: 24,796,571 T174A probably benign Het
Stam2 G T 2: 52,742,104 probably benign Het
Taar7a T C 10: 23,992,439 E348G probably benign Het
Taf11 T C 17: 27,901,670 T209A probably benign Het
Tenm4 A G 7: 96,843,217 probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Uevld A T 7: 46,926,356 S461T probably benign Het
Vmn2r6 T A 3: 64,556,033 N460I probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zfp316 T C 5: 143,263,340 Y180C unknown Het
Zfp941 A G 7: 140,812,139 S436P probably damaging Het
Zfp979 G A 4: 147,613,509 Q248* probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Arsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Arsg APN 11 109525446 missense possibly damaging 0.88
IGL02257:Arsg APN 11 109521647 splice site probably benign
IGL03069:Arsg APN 11 109563256 missense probably damaging 1.00
R0421:Arsg UTSW 11 109527766 missense probably damaging 1.00
R1235:Arsg UTSW 11 109534107 critical splice donor site probably null
R1830:Arsg UTSW 11 109563274 critical splice donor site probably null
R2831:Arsg UTSW 11 109525449 missense possibly damaging 0.61
R4573:Arsg UTSW 11 109517282 missense probably damaging 1.00
R4780:Arsg UTSW 11 109534013 missense possibly damaging 0.80
R4811:Arsg UTSW 11 109534072 missense probably benign 0.00
R5510:Arsg UTSW 11 109527874 missense probably benign 0.33
R5944:Arsg UTSW 11 109535311 missense probably damaging 0.99
R6502:Arsg UTSW 11 109517336 missense probably damaging 1.00
R6962:Arsg UTSW 11 109521669 missense probably damaging 1.00
X0019:Arsg UTSW 11 109563253 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTATAGCCACGCACCATCG -3'
(R):5'- GGTCCAGAATGCCTTTGCTG -3'

Sequencing Primer
(F):5'- CGAAGATGTTTTCTATGTGCGTCCC -3'
(R):5'- CTCCAGCCAAGTTTAAGGTTG -3'
Posted On2017-02-10