Incidental Mutation 'R5862:Usp20'
ID453952
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Nameubiquitin specific peptidase 20
Synonyms1700055M05Rik, Vdu2
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location30982279-31023586 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 31006449 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 188 (L188*)
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000125601] [ENSMUST00000128295] [ENSMUST00000138161] [ENSMUST00000170476]
Predicted Effect probably null
Transcript: ENSMUST00000061544
AA Change: L188*
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854
AA Change: L188*

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102849
AA Change: L188*
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: L188*

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125601
SMART Domains Protein: ENSMUSP00000121699
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 66 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128295
SMART Domains Protein: ENSMUSP00000115613
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136588
SMART Domains Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 10 60 6.4e-12 PFAM
low complexity region 93 103 N/A INTRINSIC
Pfam:UCH 109 142 4.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138161
SMART Domains Protein: ENSMUSP00000116696
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154634
Predicted Effect probably null
Transcript: ENSMUST00000170476
AA Change: L188*
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: L188*

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7970:Usp20 UTSW 2 31020894 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AAGAACTGGCTGTTTCCTTCTACC -3'
(R):5'- CAGTTGGGAACACGATGGAC -3'

Sequencing Primer
(F):5'- ACCATTTAGGCCATCTCTAGC -3'
(R):5'- GAACACGATGGACGCCTCATG -3'
Posted On2017-02-10