Mutagenetix > Incidental Mutations

Incidental Mutation 'R5862:Usp20'

453952

Institutional Source

Beutler Lab

Gene Symbol

Usp20

Ensembl Gene

ENSMUSG00000026854

Gene Name

ubiquitin specific peptidase 20

Synonyms

1700055M05Rik, Vdu2

MMRRC Submission

043231-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30982279-31023586 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 31006449 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 188 (L188*)

Ref Sequence

ENSEMBL: ENSMUSP00000127388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000125601] [ENSMUST00000128295] [ENSMUST00000138161] [ENSMUST00000170476]

Predicted Effect

probably null
Transcript: ENSMUST00000061544
AA Change: L188*

SMART Domains

Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854
AA Change: L188*

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	95	3.2e-18	PFAM
low complexity region	128	138	N/A	INTRINSIC
Pfam:UCH	144	210	2e-13	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102849
AA Change: L188*

SMART Domains

Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: L188*

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	95	4.3e-17	PFAM
low complexity region	128	138	N/A	INTRINSIC
Pfam:UCH	144	684	5e-63	PFAM
Pfam:UCH_1	145	669	8.8e-24	PFAM
DUSP	704	787	5.97e-28	SMART
DUSP	812	897	4.74e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125601

SMART Domains

Protein: ENSMUSP00000121699
Gene: ENSMUSG00000026854

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	66	1.6e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128295

SMART Domains

Protein: ENSMUSP00000115613
Gene: ENSMUSG00000026854

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	77	1.1e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136588

SMART Domains

Protein: ENSMUSP00000119197
Gene: ENSMUSG00000026854

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	10	60	6.4e-12	PFAM
low complexity region	93	103	N/A	INTRINSIC
Pfam:UCH	109	142	4.6e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138161

SMART Domains

Protein: ENSMUSP00000116696
Gene: ENSMUSG00000026854

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	77	1.1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154634

Predicted Effect

probably null
Transcript: ENSMUST00000170476
AA Change: L188*

SMART Domains

Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: L188*

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	95	3.4e-17	PFAM
low complexity region	128	138	N/A	INTRINSIC
Pfam:UCH	144	270	1.2e-26	PFAM
Pfam:UCH_1	145	669	6.1e-20	PFAM
Pfam:UCH	324	684	1.6e-31	PFAM
DUSP	704	787	5.97e-28	SMART
DUSP	812	897	4.74e-31	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahctf1	A	G	1: 179,788,330	Y326H	probably damaging	Het
Alpk2	T	A	18: 65,307,289	K811N	probably damaging	Het
Ap3b1	T	A	13: 94,547,770	M1014K	unknown	Het
Bphl	G	A	13: 34,063,984	V247I	possibly damaging	Het
C6	A	T	15: 4,735,263	D147V	possibly damaging	Het
Clec18a	G	A	8: 111,081,558	H71Y	possibly damaging	Het
Cse1l	A	G	2: 166,915,207	T10A	probably benign	Het
Cyp2b9	G	T	7: 26,187,807	G214C	probably benign	Het
Dctn6	A	T	8: 34,108,417		probably null	Het
Dnaja4	G	T	9: 54,699,341		probably benign	Het
Dpp8	A	T	9: 65,045,722	S227C	probably benign	Het
Ecel1	T	C	1: 87,149,596	N630S	probably benign	Het
Etnppl	T	C	3: 130,631,824	V426A	possibly damaging	Het
Golgb1	A	T	16: 36,926,091		silent	Het
H2afy	T	A	13: 56,074,271	I359L	probably damaging	Het
Hapln3	A	T	7: 79,121,891	H83Q	possibly damaging	Het
Hmgxb4	A	G	8: 75,001,055	K222R	probably damaging	Het
Hsf5	C	A	11: 87,622,991	T294K	probably damaging	Het
Ighv12-2	A	G	12: 114,127,937		noncoding transcript	Het
Lrch3	A	T	16: 32,995,809	H587L	probably damaging	Het
Mboat1	C	T	13: 30,235,697	T339M	probably damaging	Het
Mief1	G	A	15: 80,248,385	R156Q	probably benign	Het
Ms4a6b	T	A	19: 11,521,803	F94I	probably benign	Het
Neb	T	A	2: 52,179,542	R307*	probably null	Het
Neu4	A	G	1: 94,022,930	I147V	probably benign	Het
Olfr1036	T	C	2: 86,075,646	I302T	probably benign	Het
Pcyox1	A	G	6: 86,391,674		probably null	Het
Pik3ap1	T	A	19: 41,332,345	D145V	probably damaging	Het
Pja2	T	C	17: 64,297,826	D454G	probably benign	Het
Plekhg1	C	T	10: 3,937,914	T281M	probably damaging	Het
Ptprq	T	C	10: 107,565,878	I1918V	probably benign	Het
Rasgef1a	A	C	6: 118,080,444	R35S	probably benign	Het
Rnf167	A	G	11: 70,651,092	T308A	probably damaging	Het
Sfmbt2	C	T	2: 10,402,052	T54I	possibly damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Shkbp1	G	T	7: 27,343,404	S536*	probably null	Het
Taf2	C	A	15: 55,048,323	V566L	possibly damaging	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Tyms	A	T	5: 30,063,410	D97E	probably damaging	Het
Zbtb10	T	A	3: 9,265,216	S545T	probably damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Usp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Usp20	APN	2	31004950	missense	probably damaging	1.00
IGL01444:Usp20	APN	2	30998789	start codon destroyed	probably null	1.00
IGL01601:Usp20	APN	2	31011794	missense	probably benign	0.04
IGL01785:Usp20	APN	2	31017163	missense	probably benign	0.02
IGL01786:Usp20	APN	2	31017163	missense	probably benign	0.02
IGL02129:Usp20	APN	2	31004450	missense	probably benign	0.43
IGL02147:Usp20	APN	2	31006401	missense	probably damaging	1.00
IGL03396:Usp20	APN	2	31011717	missense	probably benign
BB007:Usp20	UTSW	2	31010544	missense	probably benign	0.21
BB017:Usp20	UTSW	2	31010544	missense	probably benign	0.21
PIT4453001:Usp20	UTSW	2	31017486	missense	possibly damaging	0.47
R0111:Usp20	UTSW	2	31002612	missense	probably damaging	1.00
R0369:Usp20	UTSW	2	31011104	missense	probably benign	0.00
R0479:Usp20	UTSW	2	31017475	missense	probably benign	0.18
R0538:Usp20	UTSW	2	31004450	missense	probably damaging	0.99
R1023:Usp20	UTSW	2	31007813	missense	probably damaging	1.00
R1183:Usp20	UTSW	2	31011785	missense	probably benign	0.17
R1635:Usp20	UTSW	2	31018818	missense	probably benign	0.03
R2114:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2115:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2116:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2117:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2232:Usp20	UTSW	2	31018738	missense	probably benign	0.13
R2244:Usp20	UTSW	2	31010331	missense	possibly damaging	0.65
R2883:Usp20	UTSW	2	31018800	missense	probably benign
R4734:Usp20	UTSW	2	31019824	missense	probably benign	0.31
R5507:Usp20	UTSW	2	31010226	missense	probably benign
R5770:Usp20	UTSW	2	31017508	missense	probably damaging	1.00
R6315:Usp20	UTSW	2	31017758	missense	possibly damaging	0.70
R7603:Usp20	UTSW	2	31011474	missense	probably damaging	1.00
R7887:Usp20	UTSW	2	31020894	missense	probably benign	0.34
R7930:Usp20	UTSW	2	31010544	missense	probably benign	0.21
Z1176:Usp20	UTSW	2	31019818	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGAACTGGCTGTTTCCTTCTACC -3'
(R):5'- CAGTTGGGAACACGATGGAC -3'

Sequencing Primer
(F):5'- ACCATTTAGGCCATCTCTAGC -3'
(R):5'- GAACACGATGGACGCCTCATG -3'

Posted On

2017-02-10