Incidental Mutation 'R5862:Cse1l'
ID 453956
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1-like (S. cerevisiae)
Synonyms Capts, Xpo2, 2610100P18Rik, Cas
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5862 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 166906040-166946389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166915207 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000128376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: T10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: T10A

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: T10A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: T10A

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
AA Change: T10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: T10A

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
ANU23:Cse1l UTSW 2 166927508 nonsense probably null
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R0195:Cse1l UTSW 2 166940088 missense probably benign
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4603:Cse1l UTSW 2 166944532 missense probably benign 0.09
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5782:Cse1l UTSW 2 166929001 missense probably damaging 1.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
R7871:Cse1l UTSW 2 166935671 splice site probably null
R8001:Cse1l UTSW 2 166939913 missense probably damaging 1.00
R8057:Cse1l UTSW 2 166939925 missense probably damaging 1.00
R8175:Cse1l UTSW 2 166943208 critical splice donor site probably null
R8347:Cse1l UTSW 2 166927585 missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166919684 missense probably benign 0.00
R8479:Cse1l UTSW 2 166921973 missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166943080 missense probably damaging 1.00
R9206:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9208:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9522:Cse1l UTSW 2 166934753 missense probably benign
R9599:Cse1l UTSW 2 166941466 missense probably benign
R9600:Cse1l UTSW 2 166915199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCCTGTCTAAAAGATCCTGTC -3'
(R):5'- CTGCTATGTGTCTCAAGAATCAATC -3'

Sequencing Primer
(F):5'- TGGCACAAGTTCTAGGCCATC -3'
(R):5'- ATTTCGGAGTTCAAGGCCAGC -3'
Posted On 2017-02-10