Incidental Mutation 'R5862:Etnppl'
ID453958
Institutional Source Beutler Lab
Gene Symbol Etnppl
Ensembl Gene ENSMUSG00000019232
Gene Nameethanolamine phosphate phospholyase
Synonyms1300019H02Rik, Agxt2l1
MMRRC Submission 043231-MU
Accession Numbers

Genbank: NM_027907.3, NM_001163587.1; Ensembl: ENSMUST00000072271

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location130617448-130637521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130631824 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 426 (V426A)
Ref Sequence ENSEMBL: ENSMUSP00000131294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072271] [ENSMUST00000163620] [ENSMUST00000166187]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072271
AA Change: V426A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072121
Gene: ENSMUSG00000019232
AA Change: V426A

DomainStartEndE-ValueType
Pfam:Aminotran_3 32 373 2.6e-81 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163620
AA Change: V420A

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129120
Gene: ENSMUSG00000019232
AA Change: V420A

DomainStartEndE-ValueType
Pfam:Aminotran_3 32 367 1.6e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166187
AA Change: V426A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131294
Gene: ENSMUSG00000019232
AA Change: V426A

DomainStartEndE-ValueType
Pfam:Aminotran_3 26 433 1.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170664
SMART Domains Protein: ENSMUSP00000128425
Gene: ENSMUSG00000019232

DomainStartEndE-ValueType
Pfam:Aminotran_3 2 120 4.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Etnppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Etnppl APN 3 130631778 missense possibly damaging 0.81
IGL02087:Etnppl APN 3 130626545 missense probably benign
IGL02524:Etnppl APN 3 130630671 unclassified probably benign
IGL03101:Etnppl APN 3 130622318 missense probably damaging 1.00
IGL03120:Etnppl APN 3 130620692 missense probably damaging 1.00
1mM(1):Etnppl UTSW 3 130628830 splice site probably benign
PIT4810001:Etnppl UTSW 3 130620714 missense probably benign 0.35
R0279:Etnppl UTSW 3 130629413 missense probably damaging 1.00
R1075:Etnppl UTSW 3 130629563 missense probably benign 0.01
R1117:Etnppl UTSW 3 130634563 missense probably benign 0.00
R1502:Etnppl UTSW 3 130628789 missense probably benign 0.01
R1581:Etnppl UTSW 3 130628744 missense possibly damaging 0.80
R1730:Etnppl UTSW 3 130620749 missense probably damaging 1.00
R1783:Etnppl UTSW 3 130620749 missense probably damaging 1.00
R1816:Etnppl UTSW 3 130634562 missense probably benign
R1855:Etnppl UTSW 3 130620722 missense probably benign 0.40
R1885:Etnppl UTSW 3 130629462 missense probably benign 0.04
R2330:Etnppl UTSW 3 130630575 missense probably damaging 1.00
R4067:Etnppl UTSW 3 130631793 missense probably damaging 1.00
R6183:Etnppl UTSW 3 130620317 missense probably damaging 1.00
R6374:Etnppl UTSW 3 130620693 missense probably damaging 1.00
R7169:Etnppl UTSW 3 130620696 missense probably damaging 1.00
R7324:Etnppl UTSW 3 130629575 missense probably damaging 1.00
R7654:Etnppl UTSW 3 130629511 missense probably benign 0.00
R7990:Etnppl UTSW 3 130630659 missense possibly damaging 0.73
R8348:Etnppl UTSW 3 130629492 missense probably benign 0.22
R8506:Etnppl UTSW 3 130629473 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AAGTACCCATGGCCCTTCATC -3'
(R):5'- CGAACTAAGAGTCCATGTCGC -3'

Sequencing Primer
(F):5'- ATCCCCCACTGCATGTGC -3'
(R):5'- AGAGTCCATGTCGCTAATTTTTGCAG -3'
Posted On2017-02-10