Incidental Mutation 'R0554:Fancc'
ID45396
Institutional Source Beutler Lab
Gene Symbol Fancc
Ensembl Gene ENSMUSG00000021461
Gene NameFanconi anemia, complementation group C
SynonymsFacc
MMRRC Submission 038746-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R0554 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location63285043-63497278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63317469 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 475 (S475G)
Ref Sequence ENSEMBL: ENSMUSP00000123817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073029] [ENSMUST00000099444] [ENSMUST00000161977] [ENSMUST00000163091] [ENSMUST00000220684]
Predicted Effect probably benign
Transcript: ENSMUST00000073029
AA Change: S475G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072788
Gene: ENSMUSG00000021461
AA Change: S475G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099444
AA Change: S378G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097043
Gene: ENSMUSG00000021461
AA Change: S378G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 461 5.8e-243 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159056
Predicted Effect probably benign
Transcript: ENSMUST00000159152
SMART Domains Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458

DomainStartEndE-ValueType
Leuk-A4-hydro_C 1 113 4.63e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160336
Predicted Effect probably benign
Transcript: ENSMUST00000161977
AA Change: S475G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123817
Gene: ENSMUSG00000021461
AA Change: S475G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163091
AA Change: S475G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124406
Gene: ENSMUSG00000021461
AA Change: S475G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 517 4.8e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220684
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are grossly normal, but chromosome aberrations and sensitivity to DNA crosslinkers are seen. Both sexes have fewer germ cell numbers and impaired fertility. Marrow progenitors show decrease in colony forming ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
1810024B03Rik A G 2: 127,187,276 M1T probably null Het
4930503L19Rik T C 18: 70,467,380 D386G probably damaging Het
Ace2 T A X: 164,175,951 N601K probably benign Het
Adam4 A C 12: 81,421,424 I141R probably damaging Het
Adcy10 G A 1: 165,513,130 G235S probably benign Het
Adcy5 G A 16: 35,294,017 V997I probably benign Het
Aff2 T G X: 69,864,074 W1221G possibly damaging Het
Ankrd44 T C 1: 54,763,758 N194D probably benign Het
Apba2 T G 7: 64,745,780 L668R probably damaging Het
Asph T C 4: 9,604,581 D152G probably damaging Het
Bcl3 C G 7: 19,820,066 V126L probably benign Het
Cd163 A G 6: 124,312,660 T446A probably benign Het
Cd209g C T 8: 4,134,995 probably benign Het
Cdadc1 A T 14: 59,586,452 V197E probably damaging Het
CN725425 T C 15: 91,260,763 C610R possibly damaging Het
Col6a2 A G 10: 76,611,161 probably null Het
Coro7 A G 16: 4,632,257 L576P possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Dhx57 A T 17: 80,260,236 L806* probably null Het
Dlec1 T C 9: 119,115,002 V373A probably benign Het
Dnah11 G T 12: 117,931,178 R3645S probably benign Het
Dnhd1 T C 7: 105,694,395 S1649P probably benign Het
Draxin T G 4: 148,107,963 K297N probably damaging Het
Epha7 T C 4: 28,951,401 S841P probably damaging Het
Esp8 T G 17: 40,530,275 D142E unknown Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Fmo3 T C 1: 162,954,332 N484S probably benign Het
Focad T C 4: 88,348,889 Y1046H unknown Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Fut8 A T 12: 77,364,970 I69L probably benign Het
Gm10436 T C 12: 88,177,558 T162A probably benign Het
Gm4951 G A 18: 60,245,417 R8H probably benign Het
Gnai3 A G 3: 108,123,612 I78T probably benign Het
Gpr182 T C 10: 127,751,071 I4V probably benign Het
Gpr63 T C 4: 25,007,447 M57T probably benign Het
Grm1 T A 10: 10,719,923 T654S probably benign Het
Gtf2h4 T C 17: 35,668,639 T371A probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hmcn1 T C 1: 150,719,117 N1867S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j A G 11: 3,499,644 Y713H probably damaging Het
Ints6 A T 14: 62,704,751 V511D possibly damaging Het
Itga4 A G 2: 79,279,117 Y220C probably damaging Het
Itgav T G 2: 83,794,270 S735A possibly damaging Het
Kctd16 A G 18: 40,258,439 I27V probably benign Het
Klhl6 T C 16: 19,953,593 E334G probably damaging Het
Lrmp G A 6: 145,165,287 A237T probably benign Het
Ltbp1 T A 17: 75,225,279 L116H probably damaging Het
Magohb T A 6: 131,285,697 H98L probably benign Het
Mgat2 A G 12: 69,185,392 T247A probably benign Het
Mtif2 G A 11: 29,533,398 probably null Het
Myrfl T C 10: 116,828,973 E384G probably damaging Het
Nfam1 G T 15: 83,033,209 R8S probably benign Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1022 T C 2: 85,869,519 F309S probably benign Het
Olfr310 A T 7: 86,269,657 I44N probably damaging Het
Olfr317 T C 11: 58,733,039 N42S probably damaging Het
Olfr777 T C 10: 129,268,499 T275A probably benign Het
Orc4 C T 2: 48,905,421 S431N probably benign Het
Pax2 T C 19: 44,761,861 V129A probably damaging Het
Pcdhb15 A G 18: 37,474,519 D268G probably damaging Het
Pdcd1 G A 1: 94,039,382 R264C probably damaging Het
Pi15 T A 1: 17,621,648 M187K probably benign Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plagl1 A G 10: 13,127,182 T65A probably benign Het
Prss48 T A 3: 86,000,921 Q18L probably benign Het
Prune2 T A 19: 17,125,218 C2580* probably null Het
Rab40b T A 11: 121,359,606 Q74L probably damaging Het
Raf1 A G 6: 115,623,530 I376T probably benign Het
Rbm46 A T 3: 82,865,268 F186I probably damaging Het
Reps1 C T 10: 18,123,119 T720M possibly damaging Het
Rgs22 A G 15: 36,054,709 M649T probably benign Het
Rhot1 C T 11: 80,243,438 R47* probably null Het
Rhox2f A G X: 37,571,471 Y8C possibly damaging Het
Rnf17 A G 14: 56,522,550 Y1604C probably damaging Het
Rnf40 T C 7: 127,602,584 C943R probably damaging Het
Ropn1l A T 15: 31,451,149 M63K probably benign Het
Sbf2 C A 7: 110,428,287 V501F probably damaging Het
Sh3bp1 T A 15: 78,907,267 M354K probably damaging Het
Sipa1l3 T C 7: 29,388,030 H590R possibly damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Sulf1 T C 1: 12,805,194 Y143H probably damaging Het
Tiam2 A T 17: 3,438,681 R755* probably null Het
Trim12c C A 7: 104,344,962 L228F probably damaging Het
Ttc23l G T 15: 10,530,657 Q290K probably benign Het
Uba3 T C 6: 97,191,260 probably null Het
Ugt1a10 A G 1: 88,056,095 E205G probably damaging Het
Ugt3a2 T A 15: 9,351,120 S72T probably benign Het
Upk3bl C T 5: 136,059,794 T113I probably damaging Het
Uspl1 T A 5: 149,187,834 D20E probably damaging Het
Vmn2r19 G A 6: 123,336,143 G724E probably damaging Het
Vmn2r63 T A 7: 42,933,705 K29* probably null Het
Vwf C T 6: 125,642,781 A1474V probably benign Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Zfp536 T C 7: 37,480,819 D787G probably damaging Het
Zfp692 A G 11: 58,314,227 H434R probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Fancc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fancc APN 13 63400245 missense probably damaging 1.00
IGL00846:Fancc APN 13 63340456 missense possibly damaging 0.89
IGL01404:Fancc APN 13 63361638 missense probably damaging 1.00
IGL02592:Fancc APN 13 63360197 missense probably damaging 1.00
IGL02625:Fancc APN 13 63398151 missense probably damaging 0.99
canneloni UTSW 13 63331823 intron probably benign
macaroni UTSW 13 63321865 critical splice donor site probably null
R0362:Fancc UTSW 13 63398156 missense possibly damaging 0.86
R0626:Fancc UTSW 13 63317391 missense probably damaging 0.97
R0627:Fancc UTSW 13 63317478 missense probably damaging 0.99
R0726:Fancc UTSW 13 63323411 missense probably benign 0.01
R0734:Fancc UTSW 13 63331842 missense probably damaging 1.00
R1363:Fancc UTSW 13 63361598 missense probably damaging 1.00
R1587:Fancc UTSW 13 63340432 missense probably benign 0.32
R1922:Fancc UTSW 13 63330567 missense possibly damaging 0.89
R4585:Fancc UTSW 13 63347564 missense probably benign 0.14
R4586:Fancc UTSW 13 63347564 missense probably benign 0.14
R4608:Fancc UTSW 13 63331823 intron probably benign
R5159:Fancc UTSW 13 63321865 critical splice donor site probably null
R5401:Fancc UTSW 13 63402953 missense probably damaging 1.00
R5561:Fancc UTSW 13 63317387 missense possibly damaging 0.85
R5699:Fancc UTSW 13 63330632 splice site probably null
R6200:Fancc UTSW 13 63360248 missense probably damaging 1.00
R6448:Fancc UTSW 13 63340428 missense probably damaging 0.98
R7562:Fancc UTSW 13 63403053 splice site probably null
R7615:Fancc UTSW 13 63317558 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAAGGTGACATCCTTTCTGCAAGC -3'
(R):5'- AGCGTGAAAGCATCAAGTCAGTCC -3'

Sequencing Primer
(F):5'- GCCTGTGATCTCAAAAGTCG -3'
(R):5'- GCATCAAGTCAGTCCTAGAGTCTC -3'
Posted On2013-06-11