Incidental Mutation 'R5862:Rasgef1a'
ID453960
Institutional Source Beutler Lab
Gene Symbol Rasgef1a
Ensembl Gene ENSMUSG00000030134
Gene NameRasGEF domain family, member 1A
Synonyms6330404M18Rik
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118011438-118091546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 118080444 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 35 (R35S)
Ref Sequence ENSEMBL: ENSMUSP00000145077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164960] [ENSMUST00000203482] [ENSMUST00000203804]
Predicted Effect probably benign
Transcript: ENSMUST00000164960
AA Change: R27S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132244
Gene: ENSMUSG00000030134
AA Change: R27S

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
RasGEFN 49 178 1.69e-3 SMART
RasGEF 218 470 7.23e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184597
Predicted Effect probably benign
Transcript: ENSMUST00000203482
AA Change: R35S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145077
Gene: ENSMUSG00000030134
AA Change: R35S

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
RasGEFN 49 178 1.69e-3 SMART
RasGEF 218 470 7.23e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203804
AA Change: R35S

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145214
Gene: ENSMUSG00000030134
AA Change: R35S

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
RasGEFN 49 177 1.3e-5 SMART
low complexity region 184 199 N/A INTRINSIC
RasGEF 227 479 4.5e-54 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Rasgef1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Rasgef1a APN 6 118088203 missense probably damaging 1.00
IGL01292:Rasgef1a APN 6 118080383 missense possibly damaging 0.51
IGL01457:Rasgef1a APN 6 118084545 missense probably benign 0.36
IGL02045:Rasgef1a APN 6 118089443 missense probably benign
IGL02502:Rasgef1a APN 6 118080482 missense probably benign 0.00
IGL02902:Rasgef1a APN 6 118083107 missense probably benign 0.10
IGL03224:Rasgef1a APN 6 118089806 splice site probably benign
R2001:Rasgef1a UTSW 6 118089196 missense probably benign 0.01
R4477:Rasgef1a UTSW 6 118085475 missense possibly damaging 0.59
R4863:Rasgef1a UTSW 6 118089139 missense probably benign 0.00
R5422:Rasgef1a UTSW 6 118088134 missense probably damaging 1.00
R5911:Rasgef1a UTSW 6 118084374 splice site probably null
R5914:Rasgef1a UTSW 6 118080554 missense possibly damaging 0.89
R6788:Rasgef1a UTSW 6 118087213 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATTCTCATCAGAGCTGCAGC -3'
(R):5'- GAAGATTTCCCCTCCCAGTCAC -3'

Sequencing Primer
(F):5'- TCATCAGAGCTGCAGCATCTG -3'
(R):5'- CCCAGTCACTTGCTGTTGC -3'
Posted On2017-02-10