Incidental Mutation 'R5862:Hapln3'
ID 453964
Institutional Source Beutler Lab
Gene Symbol Hapln3
Ensembl Gene ENSMUSG00000030606
Gene Name hyaluronan and proteoglycan link protein 3
Synonyms Lpr3, 4930554N11Rik
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5862 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79115102-79131018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79121891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 83 (H83Q)
Ref Sequence ENSEMBL: ENSMUSP00000032827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032827] [ENSMUST00000205782] [ENSMUST00000206092]
AlphaFold Q80WM5
Predicted Effect possibly damaging
Transcript: ENSMUST00000032827
AA Change: H83Q

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606
AA Change: H83Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205782
AA Change: H83Q

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000206092
AA Change: H83Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206402
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Hapln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hapln3 APN 7 79121983 missense probably damaging 1.00
IGL01412:Hapln3 APN 7 79117436 splice site probably null
IGL02141:Hapln3 APN 7 79118145 missense probably damaging 0.99
IGL02675:Hapln3 APN 7 79117848 critical splice donor site probably null
IGL02864:Hapln3 APN 7 79118064 missense probably benign 0.03
IGL02894:Hapln3 APN 7 79121773 missense probably benign 0.03
R1271:Hapln3 UTSW 7 79118016 missense probably damaging 1.00
R1337:Hapln3 UTSW 7 79118076 missense probably benign 0.06
R1351:Hapln3 UTSW 7 79121960 missense probably damaging 1.00
R1686:Hapln3 UTSW 7 79121890 missense probably benign 0.13
R1718:Hapln3 UTSW 7 79123450 missense unknown
R3103:Hapln3 UTSW 7 79121736 missense probably benign 0.07
R5625:Hapln3 UTSW 7 79117258 splice site probably null
R5669:Hapln3 UTSW 7 79117496 splice site probably null
R5875:Hapln3 UTSW 7 79121973 missense probably benign 0.03
R7129:Hapln3 UTSW 7 79121824 missense probably damaging 1.00
R7439:Hapln3 UTSW 7 79117269 missense probably benign 0.00
R7713:Hapln3 UTSW 7 79117373 missense probably benign 0.00
R8894:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8896:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8933:Hapln3 UTSW 7 79117630 unclassified probably benign
R9114:Hapln3 UTSW 7 79121964 missense probably benign 0.00
R9367:Hapln3 UTSW 7 79121707 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCAGGCCATCGATGAC -3'
(R):5'- ACAATTGAGTCTGAAGGGGC -3'

Sequencing Primer
(F):5'- ATGACCTCGCAGCGGTAG -3'
(R):5'- ATGAGGGTATGGGTGCTCC -3'
Posted On 2017-02-10