Incidental Mutation 'R5862:Mboat1'
ID453976
Institutional Source Beutler Lab
Gene Symbol Mboat1
Ensembl Gene ENSMUSG00000038732
Gene Namemembrane bound O-acyltransferase domain containing 1
Synonyms9130215M02Rik, Oact1
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location30136489-30246717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30235697 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 339 (T339M)
Ref Sequence ENSEMBL: ENSMUSP00000045441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047311]
Predicted Effect probably damaging
Transcript: ENSMUST00000047311
AA Change: T339M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045441
Gene: ENSMUSG00000038732
AA Change: T339M

DomainStartEndE-ValueType
Pfam:MBOAT 36 438 4.8e-29 PFAM
transmembrane domain 455 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152798
SMART Domains Protein: ENSMUSP00000121195
Gene: ENSMUSG00000038732

DomainStartEndE-ValueType
Pfam:MBOAT 9 209 1.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222095
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the membrane-bound O-acetyltransferase superfamily. The encoded transmembrane protein is an enzyme that transfers organic compounds, preferably from oleoyl-CoA, to hydroxyl groups of protein targets in membranes. A translocation disrupting this gene may be associated with brachydactyly syndactyly syndrome. Alternately spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Mboat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Mboat1 APN 13 30195793 splice site probably benign
IGL01331:Mboat1 APN 13 30219701 splice site probably benign
IGL01837:Mboat1 APN 13 30241183 missense possibly damaging 0.72
IGL02070:Mboat1 APN 13 30224397 missense probably benign 0.02
IGL03338:Mboat1 APN 13 30136759 missense probably benign 0.01
langsat UTSW 13 30202375 missense probably benign 0.37
R0201:Mboat1 UTSW 13 30202375 missense probably benign 0.37
R0322:Mboat1 UTSW 13 30232080 splice site probably benign
R0448:Mboat1 UTSW 13 30202410 missense probably damaging 1.00
R1793:Mboat1 UTSW 13 30219650 missense probably damaging 0.99
R2040:Mboat1 UTSW 13 30241317 critical splice donor site probably null
R3054:Mboat1 UTSW 13 30195741 missense probably benign
R3122:Mboat1 UTSW 13 30238048 missense probably damaging 1.00
R4948:Mboat1 UTSW 13 30241230 missense probably damaging 1.00
R4958:Mboat1 UTSW 13 30224393 missense probably damaging 1.00
R4992:Mboat1 UTSW 13 30202360 missense possibly damaging 0.80
R5429:Mboat1 UTSW 13 30219667 missense probably benign 0.02
R6025:Mboat1 UTSW 13 30224526 missense probably benign
R6352:Mboat1 UTSW 13 30202420 missense possibly damaging 0.59
R6956:Mboat1 UTSW 13 30238076 missense possibly damaging 0.89
R7088:Mboat1 UTSW 13 30195789 critical splice donor site probably null
R7165:Mboat1 UTSW 13 30224415 missense probably damaging 1.00
R7366:Mboat1 UTSW 13 30202362 missense possibly damaging 0.94
R7727:Mboat1 UTSW 13 30226306 missense probably benign 0.00
R7938:Mboat1 UTSW 13 30231976 missense possibly damaging 0.53
R8239:Mboat1 UTSW 13 30245350 missense probably damaging 1.00
Z1177:Mboat1 UTSW 13 30226378 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCTGGGCAGATTCAAGTTTC -3'
(R):5'- AAAGTGTCAGACTGCATGGC -3'

Sequencing Primer
(F):5'- CTGGGCAGATTCAAGTTTCCAAGC -3'
(R):5'- CGGTCAGCAGCTGCATGAC -3'
Posted On2017-02-10