Incidental Mutation 'R5862:Bphl'
ID453977
Institutional Source Beutler Lab
Gene Symbol Bphl
Ensembl Gene ENSMUSG00000038286
Gene Namebiphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen)
Synonyms
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5862 (G1)
Quality Score197
Status Not validated
Chromosome13
Chromosomal Location34037597-34074074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34063984 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 247 (V247I)
Ref Sequence ENSEMBL: ENSMUSP00000046168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040656] [ENSMUST00000222658]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040656
AA Change: V247I

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046168
Gene: ENSMUSG00000038286
AA Change: V247I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Pfam:Hydrolase_4 57 208 1.1e-10 PFAM
Pfam:Abhydrolase_1 61 205 2.8e-22 PFAM
Pfam:Abhydrolase_5 62 273 3.9e-20 PFAM
Pfam:Abhydrolase_6 63 285 6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221124
Predicted Effect probably benign
Transcript: ENSMUST00000222658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223251
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine protease family of hydrolytic enzymes which contain a serine in their active site. The encoded protein may play a role in activation of the antiviral prodrug valacyclovir. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Bphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Bphl APN 13 34063997 missense probably damaging 1.00
IGL03087:Bphl APN 13 34073711 missense probably damaging 1.00
R0127:Bphl UTSW 13 34064046 unclassified probably benign
R0494:Bphl UTSW 13 34037771 makesense probably null
R1475:Bphl UTSW 13 34060524 missense probably benign
R6849:Bphl UTSW 13 34050269 splice site probably null
R7325:Bphl UTSW 13 34050341 missense possibly damaging 0.49
R7528:Bphl UTSW 13 34060490 missense probably damaging 1.00
R7952:Bphl UTSW 13 34046797 missense probably benign 0.10
R8497:Bphl UTSW 13 34037723 missense possibly damaging 0.53
X0009:Bphl UTSW 13 34037763 missense probably benign 0.06
X0010:Bphl UTSW 13 34037763 missense probably benign 0.06
X0011:Bphl UTSW 13 34037763 missense probably benign 0.06
X0014:Bphl UTSW 13 34037763 missense probably benign 0.06
X0017:Bphl UTSW 13 34037763 missense probably benign 0.06
X0021:Bphl UTSW 13 34037763 missense probably benign 0.06
X0023:Bphl UTSW 13 34037763 missense probably benign 0.06
X0033:Bphl UTSW 13 34037763 missense probably benign 0.06
X0064:Bphl UTSW 13 34037763 missense probably benign 0.06
X0067:Bphl UTSW 13 34037763 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCTTTTGCAGCATTGAAGTC -3'
(R):5'- TACTAGGATCCTTCTGCCGAGG -3'

Sequencing Primer
(F):5'- TGCAGCATTGAAGTCCAAAGTC -3'
(R):5'- CTGTGGTACTCTCTGACCAAATGAG -3'
Posted On2017-02-10