Incidental Mutation 'R5862:Alpk2'
ID453987
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission 043231-MU
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65307289 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 811 (K811N)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035548
AA Change: K811N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: K811N

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141250
AA Change: K344N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: K344N

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
R8171:Alpk2 UTSW 18 65305983 missense probably benign 0.00
R8280:Alpk2 UTSW 18 65307203 missense probably benign
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGCATCTTCACTGGCCTC -3'
(R):5'- GCCTGTGAACTGAGTCTCCTAG -3'

Sequencing Primer
(F):5'- TACTGTTAAAAAGAAGGCCCTCG -3'
(R):5'- CTGTGAACTGAGTCTCCTAGAAGAC -3'
Posted On2017-02-10