Incidental Mutation 'R5863:Als2cr12'
ID453992
Institutional Source Beutler Lab
Gene Symbol Als2cr12
Ensembl Gene ENSMUSG00000047528
Gene Nameamyotrophic lateral sclerosis 2 chromosome region 12
Synonyms4933425F06Rik, 4933405P16Rik
MMRRC Submission 043232-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5863 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58646903-58695989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58691749 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 49 (H49Q)
Ref Sequence ENSEMBL: ENSMUSP00000140780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055313] [ENSMUST00000188772] [ENSMUST00000191252] [ENSMUST00000191565]
Predicted Effect probably benign
Transcript: ENSMUST00000055313
AA Change: H49Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062497
Gene: ENSMUSG00000047528
AA Change: H49Q

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185953
Predicted Effect probably benign
Transcript: ENSMUST00000188772
AA Change: H49Q

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140780
Gene: ENSMUSG00000047528
AA Change: H49Q

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188839
Predicted Effect probably benign
Transcript: ENSMUST00000191252
AA Change: H49Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000191565
AA Change: H49Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139420
Gene: ENSMUSG00000047528
AA Change: H49Q

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Meta Mutation Damage Score 0.0690 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,503,223 I204T possibly damaging Het
Abcc2 A G 19: 43,798,136 I136V probably benign Het
Adam6a T C 12: 113,544,367 I120T probably benign Het
Add3 C A 19: 53,233,870 L303I probably benign Het
Anln A G 9: 22,337,984 L149P probably damaging Het
Arhgef4 A G 1: 34,722,845 E394G unknown Het
Asns G A 6: 7,675,443 Q520* probably null Het
Auh T G 13: 52,898,658 N141T probably benign Het
B3galt2 G A 1: 143,646,366 R80Q probably benign Het
Bcl9 T C 3: 97,210,350 T343A probably benign Het
C3 T A 17: 57,223,141 I487F probably benign Het
Cast T C 13: 74,736,756 K326E probably damaging Het
Ccdc185 T A 1: 182,748,557 H189L possibly damaging Het
Cep112 A G 11: 108,606,232 E51G probably damaging Het
Cpvl G A 6: 53,873,428 P475S probably damaging Het
Cstf2t G T 19: 31,083,077 L4F probably damaging Het
Dido1 A G 2: 180,661,773 V1446A probably benign Het
Dlg2 T A 7: 91,711,779 M35K probably benign Het
Dnah12 C T 14: 26,854,921 L3043F probably damaging Het
Fam135a A G 1: 24,014,782 S1225P possibly damaging Het
Fhod3 T C 18: 25,125,753 F1443S probably benign Het
Gm14226 C A 2: 155,024,291 T56N probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kcnj8 T A 6: 142,565,688 I398F probably benign Het
Khdrbs1 G A 4: 129,722,700 R284C probably damaging Het
Nog A G 11: 89,301,530 L164P probably damaging Het
Olfr46 G A 7: 140,610,631 G155D probably damaging Het
Olfr898 T C 9: 38,349,787 S235P probably benign Het
Pkhd1 T A 1: 20,520,210 Q1771L possibly damaging Het
Prl3c1 T A 13: 27,203,610 *193K probably null Het
Prpf4b T A 13: 34,899,128 I829N possibly damaging Het
Rassf1 C T 9: 107,557,824 P103S probably damaging Het
Rdh16f2 A C 10: 127,876,387 I238L probably benign Het
Sdk2 G T 11: 113,834,984 D1146E probably damaging Het
Slc16a3 T C 11: 120,957,953 F412L probably benign Het
Slc24a1 T C 9: 64,928,542 T768A unknown Het
Stk32a A G 18: 43,315,144 N396S probably benign Het
Ston1 T C 17: 88,635,945 S260P possibly damaging Het
Tmem135 A G 7: 89,147,968 probably null Het
Tmem30c A G 16: 57,270,055 V263A probably benign Het
Ttn T A 2: 76,756,758 T21632S probably damaging Het
Ube2w A G 1: 16,585,307 I141T probably damaging Het
Zfp651 A G 9: 121,767,530 S651G probably benign Het
Zscan20 A T 4: 128,586,348 C783* probably null Het
Other mutations in Als2cr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Als2cr12 APN 1 58670394 missense probably damaging 0.98
IGL02549:Als2cr12 APN 1 58659282 missense probably benign 0.05
IGL02647:Als2cr12 APN 1 58670454 missense probably benign
IGL03098:Als2cr12 UTSW 1 58691749 missense probably benign 0.06
PIT4504001:Als2cr12 UTSW 1 58659099 missense probably benign 0.20
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1959:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R1960:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R3815:Als2cr12 UTSW 1 58659005 missense probably damaging 0.98
R4445:Als2cr12 UTSW 1 58666921 missense possibly damaging 0.83
R4617:Als2cr12 UTSW 1 58661442 missense probably benign 0.19
R4720:Als2cr12 UTSW 1 58678348 missense possibly damaging 0.46
R4816:Als2cr12 UTSW 1 58670408 missense probably benign 0.10
R4947:Als2cr12 UTSW 1 58676539 missense probably benign 0.05
R4960:Als2cr12 UTSW 1 58667806 missense probably damaging 0.98
R4970:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5018:Als2cr12 UTSW 1 58690950 missense probably benign
R5112:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5269:Als2cr12 UTSW 1 58691760 missense possibly damaging 0.83
R5426:Als2cr12 UTSW 1 58666886 nonsense probably null
R5541:Als2cr12 UTSW 1 58658429 missense probably benign 0.03
R5845:Als2cr12 UTSW 1 58667778 missense possibly damaging 0.46
R6364:Als2cr12 UTSW 1 58658372 missense probably damaging 0.96
R6430:Als2cr12 UTSW 1 58678289 missense probably damaging 0.98
R6527:Als2cr12 UTSW 1 58692413 start codon destroyed probably null 0.01
R6573:Als2cr12 UTSW 1 58666844 missense probably benign 0.27
R7367:Als2cr12 UTSW 1 58666864 missense probably benign 0.07
R7459:Als2cr12 UTSW 1 58691752 missense possibly damaging 0.46
R7497:Als2cr12 UTSW 1 58678308 missense probably damaging 1.00
R8317:Als2cr12 UTSW 1 58676548 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTAGGGTAATTTGTTGGCACAG -3'
(R):5'- TCGTGCTGATGACCAGGAGATAG -3'

Sequencing Primer
(F):5'- CAGGGCCTCAGTGAAGAAGTCC -3'
(R):5'- TAGATAAGAACCTGCACCTTGG -3'
Posted On2017-02-10