Incidental Mutation 'R5863:Zscan20'
ID454001
Institutional Source Beutler Lab
Gene Symbol Zscan20
Ensembl Gene ENSMUSG00000061894
Gene Namezinc finger and SCAN domains 20
SynonymsZfp31
MMRRC Submission 043232-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5863 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location128583539-128610098 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 128586348 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 783 (C783*)
Ref Sequence ENSEMBL: ENSMUSP00000095487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097877] [ENSMUST00000135309]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084276
Predicted Effect probably null
Transcript: ENSMUST00000097877
AA Change: C783*
SMART Domains Protein: ENSMUSP00000095487
Gene: ENSMUSG00000061894
AA Change: C783*

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 275 284 N/A INTRINSIC
SANT 314 378 8.04e-1 SMART
SANT 475 539 4.85e-3 SMART
ZnF_C2H2 725 747 2.61e1 SMART
ZnF_C2H2 753 775 9.88e-5 SMART
ZnF_C2H2 781 803 1.12e-3 SMART
ZnF_C2H2 862 884 3.21e-4 SMART
ZnF_C2H2 890 912 1.04e-3 SMART
ZnF_C2H2 918 940 1.56e-2 SMART
ZnF_C2H2 946 968 2.84e-5 SMART
ZnF_C2H2 974 996 4.54e-4 SMART
ZnF_C2H2 1002 1024 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135309
SMART Domains Protein: ENSMUSP00000119338
Gene: ENSMUSG00000061894

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 279 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,503,223 I204T possibly damaging Het
Abcc2 A G 19: 43,798,136 I136V probably benign Het
Adam6a T C 12: 113,544,367 I120T probably benign Het
Add3 C A 19: 53,233,870 L303I probably benign Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Anln A G 9: 22,337,984 L149P probably damaging Het
Arhgef4 A G 1: 34,722,845 E394G unknown Het
Asns G A 6: 7,675,443 Q520* probably null Het
Auh T G 13: 52,898,658 N141T probably benign Het
B3galt2 G A 1: 143,646,366 R80Q probably benign Het
Bcl9 T C 3: 97,210,350 T343A probably benign Het
C3 T A 17: 57,223,141 I487F probably benign Het
Cast T C 13: 74,736,756 K326E probably damaging Het
Ccdc185 T A 1: 182,748,557 H189L possibly damaging Het
Cep112 A G 11: 108,606,232 E51G probably damaging Het
Cpvl G A 6: 53,873,428 P475S probably damaging Het
Cstf2t G T 19: 31,083,077 L4F probably damaging Het
Dido1 A G 2: 180,661,773 V1446A probably benign Het
Dlg2 T A 7: 91,711,779 M35K probably benign Het
Dnah12 C T 14: 26,854,921 L3043F probably damaging Het
Fam135a A G 1: 24,014,782 S1225P possibly damaging Het
Fhod3 T C 18: 25,125,753 F1443S probably benign Het
Gm14226 C A 2: 155,024,291 T56N probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kcnj8 T A 6: 142,565,688 I398F probably benign Het
Khdrbs1 G A 4: 129,722,700 R284C probably damaging Het
Nog A G 11: 89,301,530 L164P probably damaging Het
Olfr46 G A 7: 140,610,631 G155D probably damaging Het
Olfr898 T C 9: 38,349,787 S235P probably benign Het
Pkhd1 T A 1: 20,520,210 Q1771L possibly damaging Het
Prl3c1 T A 13: 27,203,610 *193K probably null Het
Prpf4b T A 13: 34,899,128 I829N possibly damaging Het
Rassf1 C T 9: 107,557,824 P103S probably damaging Het
Rdh16f2 A C 10: 127,876,387 I238L probably benign Het
Sdk2 G T 11: 113,834,984 D1146E probably damaging Het
Slc16a3 T C 11: 120,957,953 F412L probably benign Het
Slc24a1 T C 9: 64,928,542 T768A unknown Het
Stk32a A G 18: 43,315,144 N396S probably benign Het
Ston1 T C 17: 88,635,945 S260P possibly damaging Het
Tmem135 A G 7: 89,147,968 probably null Het
Tmem30c A G 16: 57,270,055 V263A probably benign Het
Ttn T A 2: 76,756,758 T21632S probably damaging Het
Ube2w A G 1: 16,585,307 I141T probably damaging Het
Zfp651 A G 9: 121,767,530 S651G probably benign Het
Other mutations in Zscan20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Zscan20 APN 4 128586635 missense probably damaging 0.99
IGL01454:Zscan20 APN 4 128589541 missense probably benign 0.01
IGL01934:Zscan20 APN 4 128592484 missense possibly damaging 0.94
IGL02288:Zscan20 APN 4 128586643 missense probably damaging 1.00
IGL02336:Zscan20 APN 4 128585794 missense probably damaging 1.00
IGL02385:Zscan20 APN 4 128604599 missense possibly damaging 0.66
IGL02437:Zscan20 APN 4 128588417 missense probably damaging 1.00
IGL02450:Zscan20 APN 4 128586657 missense probably damaging 0.99
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0070:Zscan20 UTSW 4 128585882 missense possibly damaging 0.73
R0142:Zscan20 UTSW 4 128585837 missense probably benign 0.38
R0496:Zscan20 UTSW 4 128591889 missense probably benign 0.42
R0567:Zscan20 UTSW 4 128589450 critical splice donor site probably null
R1333:Zscan20 UTSW 4 128588096 missense possibly damaging 0.61
R1716:Zscan20 UTSW 4 128586541 missense probably damaging 0.96
R2302:Zscan20 UTSW 4 128588264 missense probably damaging 1.00
R3870:Zscan20 UTSW 4 128586425 missense probably damaging 1.00
R4611:Zscan20 UTSW 4 128588106 missense probably benign 0.00
R4884:Zscan20 UTSW 4 128588165 missense possibly damaging 0.56
R4972:Zscan20 UTSW 4 128592359 missense probably benign 0.39
R5033:Zscan20 UTSW 4 128586128 missense probably benign 0.01
R5160:Zscan20 UTSW 4 128592482 missense possibly damaging 0.69
R5182:Zscan20 UTSW 4 128586711 missense possibly damaging 0.71
R5214:Zscan20 UTSW 4 128588316 missense probably benign 0.00
R5345:Zscan20 UTSW 4 128588121 missense probably benign 0.04
R6217:Zscan20 UTSW 4 128604534 missense probably damaging 1.00
R6597:Zscan20 UTSW 4 128585746 missense probably damaging 0.96
R6751:Zscan20 UTSW 4 128585875 missense probably damaging 1.00
R6852:Zscan20 UTSW 4 128589722 missense probably damaging 1.00
R7172:Zscan20 UTSW 4 128585676 nonsense probably null
R7338:Zscan20 UTSW 4 128588150 missense probably benign
R7805:Zscan20 UTSW 4 128585806 missense probably damaging 1.00
R8063:Zscan20 UTSW 4 128586235 missense probably benign 0.01
R8244:Zscan20 UTSW 4 128585966 missense probably benign 0.32
R8421:Zscan20 UTSW 4 128585827 missense probably damaging 1.00
R8752:Zscan20 UTSW 4 128585687 missense probably damaging 1.00
R8939:Zscan20 UTSW 4 128604522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCTGAGGTTCTTTAGGTCCC -3'
(R):5'- AAGTGCATTTCTTTGCCCCG -3'

Sequencing Primer
(F):5'- AGGTCCCTCCTGTGTAGAATTTCG -3'
(R):5'- TGAGAAACCCTACAAGTGTCTTGGC -3'
Posted On2017-02-10