Incidental Mutation 'R5863:Kcnj8'
ID454007
Institutional Source Beutler Lab
Gene Symbol Kcnj8
Ensembl Gene ENSMUSG00000030247
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 8
SynonymsKir6.1, sltr, gnite, slmbr
MMRRC Submission 043232-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5863 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142564837-142571614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142565688 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 398 (I398F)
Ref Sequence ENSEMBL: ENSMUSP00000145440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032374] [ENSMUST00000203945]
Predicted Effect probably benign
Transcript: ENSMUST00000032374
SMART Domains Protein: ENSMUSP00000032374
Gene: ENSMUSG00000030247

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203945
AA Change: I398F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145440
Gene: ENSMUSG00000030247
AA Change: I398F

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. Defects in this gene may be a cause of J-wave syndromes and sudden infant death syndrome (SIDS). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit sudden cardiac death due to dysregulation of the vascular tonus in the coronary arteries, and exhibit a phenotype resembling Prinzmetal (or variant) angina in humans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,503,223 I204T possibly damaging Het
Abcc2 A G 19: 43,798,136 I136V probably benign Het
Adam6a T C 12: 113,544,367 I120T probably benign Het
Add3 C A 19: 53,233,870 L303I probably benign Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Anln A G 9: 22,337,984 L149P probably damaging Het
Arhgef4 A G 1: 34,722,845 E394G unknown Het
Asns G A 6: 7,675,443 Q520* probably null Het
Auh T G 13: 52,898,658 N141T probably benign Het
B3galt2 G A 1: 143,646,366 R80Q probably benign Het
Bcl9 T C 3: 97,210,350 T343A probably benign Het
C3 T A 17: 57,223,141 I487F probably benign Het
Cast T C 13: 74,736,756 K326E probably damaging Het
Ccdc185 T A 1: 182,748,557 H189L possibly damaging Het
Cep112 A G 11: 108,606,232 E51G probably damaging Het
Cpvl G A 6: 53,873,428 P475S probably damaging Het
Cstf2t G T 19: 31,083,077 L4F probably damaging Het
Dido1 A G 2: 180,661,773 V1446A probably benign Het
Dlg2 T A 7: 91,711,779 M35K probably benign Het
Dnah12 C T 14: 26,854,921 L3043F probably damaging Het
Fam135a A G 1: 24,014,782 S1225P possibly damaging Het
Fhod3 T C 18: 25,125,753 F1443S probably benign Het
Gm14226 C A 2: 155,024,291 T56N probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Khdrbs1 G A 4: 129,722,700 R284C probably damaging Het
Nog A G 11: 89,301,530 L164P probably damaging Het
Olfr46 G A 7: 140,610,631 G155D probably damaging Het
Olfr898 T C 9: 38,349,787 S235P probably benign Het
Pkhd1 T A 1: 20,520,210 Q1771L possibly damaging Het
Prl3c1 T A 13: 27,203,610 *193K probably null Het
Prpf4b T A 13: 34,899,128 I829N possibly damaging Het
Rassf1 C T 9: 107,557,824 P103S probably damaging Het
Rdh16f2 A C 10: 127,876,387 I238L probably benign Het
Sdk2 G T 11: 113,834,984 D1146E probably damaging Het
Slc16a3 T C 11: 120,957,953 F412L probably benign Het
Slc24a1 T C 9: 64,928,542 T768A unknown Het
Stk32a A G 18: 43,315,144 N396S probably benign Het
Ston1 T C 17: 88,635,945 S260P possibly damaging Het
Tmem135 A G 7: 89,147,968 probably null Het
Tmem30c A G 16: 57,270,055 V263A probably benign Het
Ttn T A 2: 76,756,758 T21632S probably damaging Het
Ube2w A G 1: 16,585,307 I141T probably damaging Het
Zfp651 A G 9: 121,767,530 S651G probably benign Het
Zscan20 A T 4: 128,586,348 C783* probably null Het
Other mutations in Kcnj8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnj8 APN 6 142570235 missense probably damaging 1.00
IGL02303:Kcnj8 APN 6 142570111 missense probably benign 0.01
IGL03026:Kcnj8 APN 6 142566473 critical splice acceptor site probably null
goodnight UTSW 6 large deletion
mayday UTSW 6 large deletion
slumber UTSW 6 large deletion
solitaire UTSW 6 large deletion
sos UTSW 6 142565927 missense probably damaging 1.00
R0278:Kcnj8 UTSW 6 142570348 missense probably benign 0.12
R0927:Kcnj8 UTSW 6 142565901 missense possibly damaging 0.82
R1680:Kcnj8 UTSW 6 142570189 nonsense probably null
R1864:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R1865:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R2087:Kcnj8 UTSW 6 142565696 missense probably benign 0.02
R4900:Kcnj8 UTSW 6 142566495 missense probably damaging 1.00
R6493:Kcnj8 UTSW 6 142566047 missense probably damaging 1.00
R6598:Kcnj8 UTSW 6 142570233 missense probably damaging 1.00
R7068:Kcnj8 UTSW 6 142566239 missense probably damaging 1.00
R7587:Kcnj8 UTSW 6 142566339 missense probably damaging 1.00
R7698:Kcnj8 UTSW 6 142565753 missense probably damaging 1.00
R7908:Kcnj8 UTSW 6 142566029 missense probably benign 0.44
R7989:Kcnj8 UTSW 6 142566029 missense probably benign 0.44
X0018:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0020:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0026:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0027:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0061:Kcnj8 UTSW 6 142570120 missense probably damaging 1.00
X0065:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCGGATTGTCTCTCAGTCATCAG -3'
(R):5'- CACCGCTTCGTGTCAATTGTG -3'

Sequencing Primer
(F):5'- TCAGGACACAGTGACTGTTC -3'
(R):5'- GCGTGTACTCTGTGGACTATTCC -3'
Posted On2017-02-10