Incidental Mutation 'R5863:Olfr46'
ID454010
Institutional Source Beutler Lab
Gene Symbol Olfr46
Ensembl Gene ENSMUSG00000093942
Gene Nameolfactory receptor 46
SynonymsID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7
MMRRC Submission 043232-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5863 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140601269-140617678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140610631 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 155 (G155D)
Ref Sequence ENSEMBL: ENSMUSP00000072445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]
Predicted Effect probably damaging
Transcript: ENSMUST00000072655
AA Change: G155D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: G155D

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 43 209 5.9e-8 PFAM
Pfam:7tm_1 49 298 3.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211771
AA Change: G147D

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214180
AA Change: G147D

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,503,223 I204T possibly damaging Het
Abcc2 A G 19: 43,798,136 I136V probably benign Het
Adam6a T C 12: 113,544,367 I120T probably benign Het
Add3 C A 19: 53,233,870 L303I probably benign Het
Als2cr12 G T 1: 58,691,749 H49Q probably benign Het
Anln A G 9: 22,337,984 L149P probably damaging Het
Arhgef4 A G 1: 34,722,845 E394G unknown Het
Asns G A 6: 7,675,443 Q520* probably null Het
Auh T G 13: 52,898,658 N141T probably benign Het
B3galt2 G A 1: 143,646,366 R80Q probably benign Het
Bcl9 T C 3: 97,210,350 T343A probably benign Het
C3 T A 17: 57,223,141 I487F probably benign Het
Cast T C 13: 74,736,756 K326E probably damaging Het
Ccdc185 T A 1: 182,748,557 H189L possibly damaging Het
Cep112 A G 11: 108,606,232 E51G probably damaging Het
Cpvl G A 6: 53,873,428 P475S probably damaging Het
Cstf2t G T 19: 31,083,077 L4F probably damaging Het
Dido1 A G 2: 180,661,773 V1446A probably benign Het
Dlg2 T A 7: 91,711,779 M35K probably benign Het
Dnah12 C T 14: 26,854,921 L3043F probably damaging Het
Fam135a A G 1: 24,014,782 S1225P possibly damaging Het
Fhod3 T C 18: 25,125,753 F1443S probably benign Het
Gm14226 C A 2: 155,024,291 T56N probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kcnj8 T A 6: 142,565,688 I398F probably benign Het
Khdrbs1 G A 4: 129,722,700 R284C probably damaging Het
Nog A G 11: 89,301,530 L164P probably damaging Het
Olfr898 T C 9: 38,349,787 S235P probably benign Het
Pkhd1 T A 1: 20,520,210 Q1771L possibly damaging Het
Prl3c1 T A 13: 27,203,610 *193K probably null Het
Prpf4b T A 13: 34,899,128 I829N possibly damaging Het
Rassf1 C T 9: 107,557,824 P103S probably damaging Het
Rdh16f2 A C 10: 127,876,387 I238L probably benign Het
Sdk2 G T 11: 113,834,984 D1146E probably damaging Het
Slc16a3 T C 11: 120,957,953 F412L probably benign Het
Slc24a1 T C 9: 64,928,542 T768A unknown Het
Stk32a A G 18: 43,315,144 N396S probably benign Het
Ston1 T C 17: 88,635,945 S260P possibly damaging Het
Tmem135 A G 7: 89,147,968 probably null Het
Tmem30c A G 16: 57,270,055 V263A probably benign Het
Ttn T A 2: 76,756,758 T21632S probably damaging Het
Ube2w A G 1: 16,585,307 I141T probably damaging Het
Zfp651 A G 9: 121,767,530 S651G probably benign Het
Zscan20 A T 4: 128,586,348 C783* probably null Het
Other mutations in Olfr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr46 APN 7 140610753 missense probably damaging 1.00
IGL02408:Olfr46 APN 7 140610931 missense probably damaging 1.00
IGL02496:Olfr46 APN 7 140610168 start codon destroyed probably benign
IGL03003:Olfr46 APN 7 140610370 missense probably damaging 1.00
R0538:Olfr46 UTSW 7 140610384 missense probably damaging 1.00
R1350:Olfr46 UTSW 7 140610709 missense probably damaging 0.96
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R2008:Olfr46 UTSW 7 140610585 missense probably damaging 1.00
R4110:Olfr46 UTSW 7 140610264 missense probably benign 0.20
R4110:Olfr46 UTSW 7 140610265 missense possibly damaging 0.89
R4255:Olfr46 UTSW 7 140610587 nonsense probably null
R4622:Olfr46 UTSW 7 140610698 nonsense probably null
R4809:Olfr46 UTSW 7 140611074 missense probably damaging 0.98
R4826:Olfr46 UTSW 7 140610319 missense probably benign 0.02
R4989:Olfr46 UTSW 7 140610391 missense possibly damaging 0.95
R5177:Olfr46 UTSW 7 140610189 missense probably benign 0.00
R5261:Olfr46 UTSW 7 140610663 missense probably benign 0.00
R5770:Olfr46 UTSW 7 140610943 missense probably damaging 1.00
R6082:Olfr46 UTSW 7 140610681 missense probably benign 0.00
R6705:Olfr46 UTSW 7 140610784 missense probably damaging 0.99
R7216:Olfr46 UTSW 7 140610460 missense possibly damaging 0.87
R7443:Olfr46 UTSW 7 140611048 missense probably damaging 1.00
R7485:Olfr46 UTSW 7 140610178 missense probably benign 0.02
R7806:Olfr46 UTSW 7 140610772 missense probably benign 0.00
R8373:Olfr46 UTSW 7 140610295 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AACACCATCTCCTTCAAAGGGTG -3'
(R):5'- CAATGATGCAGCCATAGGATAGC -3'

Sequencing Primer
(F):5'- TCCTTCAAAGGGTGCATGAC -3'
(R):5'- TGCAGCCATAGGATAGCAAGGTAAG -3'
Posted On2017-02-10