Incidental Mutation 'R5863:Nog'
ID 454017
Institutional Source Beutler Lab
Gene Symbol Nog
Ensembl Gene ENSMUSG00000048616
Gene Name noggin
Synonyms
MMRRC Submission 043232-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5863 (G1)
Quality Score 189
Status Not validated
Chromosome 11
Chromosomal Location 89191464-89193158 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89192356 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 164 (L164P)
Ref Sequence ENSEMBL: ENSMUSP00000061427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061728]
AlphaFold P97466
Predicted Effect probably damaging
Transcript: ENSMUST00000061728
AA Change: L164P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061427
Gene: ENSMUSG00000048616
AA Change: L164P

DomainStartEndE-ValueType
Pfam:Noggin 12 232 4.4e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140754
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The secreted polypeptide, encoded by this gene, binds and inactivates members of the transforming growth factor-beta (TGF-beta) superfamily signaling proteins, such as bone morphogenetic protein-4 (BMP4). By diffusing through extracellular matrices more efficiently than members of the TGF-beta superfamily, this protein may have a principal role in creating morphogenic gradients. The protein appears to have pleiotropic effect, both early in development as well as in later stages. It was originally isolated from Xenopus based on its ability to restore normal dorsal-ventral body axis in embryos that had been artificially ventralized by UV treatment. The results of the mouse knockout of the ortholog suggest that it is involved in numerous developmental processes, such as neural tube fusion and joint formation. Recently, several dominant human NOG mutations in unrelated families with proximal symphalangism (SYM1) and multiple synostoses syndrome (SYNS1) were identified; both SYM1 and SYNS1 have multiple joint fusion as their principal feature, and map to the same region (17q22) as this gene. All of these mutations altered evolutionarily conserved amino acid residues. The amino acid sequence of this human gene is highly homologous to that of Xenopus, rat and mouse. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed closure of neural tube, exencephaly, wide club-shaped limbs, loss of tail vertebrae, shortened body axis, abnormal cartilage condensations, and lethality at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,580,287 (GRCm39) I204T possibly damaging Het
Abcc2 A G 19: 43,786,575 (GRCm39) I136V probably benign Het
Adam6a T C 12: 113,507,987 (GRCm39) I120T probably benign Het
Add3 C A 19: 53,222,301 (GRCm39) L303I probably benign Het
Anln A G 9: 22,249,280 (GRCm39) L149P probably damaging Het
Arhgef4 A G 1: 34,761,926 (GRCm39) E394G unknown Het
Asns G A 6: 7,675,443 (GRCm39) Q520* probably null Het
Auh T G 13: 53,052,694 (GRCm39) N141T probably benign Het
B3galt2 G A 1: 143,522,104 (GRCm39) R80Q probably benign Het
Bcl9 T C 3: 97,117,666 (GRCm39) T343A probably benign Het
C3 T A 17: 57,530,141 (GRCm39) I487F probably benign Het
Cast T C 13: 74,884,875 (GRCm39) K326E probably damaging Het
Ccdc185 T A 1: 182,576,122 (GRCm39) H189L possibly damaging Het
Cep112 A G 11: 108,497,058 (GRCm39) E51G probably damaging Het
Cpvl G A 6: 53,850,413 (GRCm39) P475S probably damaging Het
Cstf2t G T 19: 31,060,477 (GRCm39) L4F probably damaging Het
Dido1 A G 2: 180,303,566 (GRCm39) V1446A probably benign Het
Dlg2 T A 7: 91,360,987 (GRCm39) M35K probably benign Het
Dnah12 C T 14: 26,576,878 (GRCm39) L3043F probably damaging Het
Fam135a A G 1: 24,053,863 (GRCm39) S1225P possibly damaging Het
Fhod3 T C 18: 25,258,810 (GRCm39) F1443S probably benign Het
Flacc1 G T 1: 58,730,908 (GRCm39) H49Q probably benign Het
Gm14226 C A 2: 154,866,211 (GRCm39) T56N probably benign Het
Itgb4 C T 11: 115,881,748 (GRCm39) R766W probably damaging Het
Kcnj8 T A 6: 142,511,414 (GRCm39) I398F probably benign Het
Khdrbs1 G A 4: 129,616,493 (GRCm39) R284C probably damaging Het
Or13a18 G A 7: 140,190,544 (GRCm39) G155D probably damaging Het
Or8c20 T C 9: 38,261,083 (GRCm39) S235P probably benign Het
Pkhd1 T A 1: 20,590,434 (GRCm39) Q1771L possibly damaging Het
Prl3c1 T A 13: 27,387,593 (GRCm39) *193K probably null Het
Prpf4b T A 13: 35,083,111 (GRCm39) I829N possibly damaging Het
Rassf1 C T 9: 107,435,023 (GRCm39) P103S probably damaging Het
Rdh16f2 A C 10: 127,712,256 (GRCm39) I238L probably benign Het
Sdk2 G T 11: 113,725,810 (GRCm39) D1146E probably damaging Het
Slc16a3 T C 11: 120,848,779 (GRCm39) F412L probably benign Het
Slc24a1 T C 9: 64,835,824 (GRCm39) T768A unknown Het
Stk32a A G 18: 43,448,209 (GRCm39) N396S probably benign Het
Ston1 T C 17: 88,943,373 (GRCm39) S260P possibly damaging Het
Tmem135 A G 7: 88,797,176 (GRCm39) probably null Het
Tmem30c A G 16: 57,090,418 (GRCm39) V263A probably benign Het
Ttn T A 2: 76,587,102 (GRCm39) T21632S probably damaging Het
Ube2w A G 1: 16,655,531 (GRCm39) I141T probably damaging Het
Zbtb47 A G 9: 121,596,596 (GRCm39) S651G probably benign Het
Zscan20 A T 4: 128,480,141 (GRCm39) C783* probably null Het
Other mutations in Nog
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1747:Nog UTSW 11 89,192,408 (GRCm39) missense probably benign 0.00
R4553:Nog UTSW 11 89,192,248 (GRCm39) missense probably damaging 1.00
R5763:Nog UTSW 11 89,192,291 (GRCm39) missense probably damaging 1.00
R9129:Nog UTSW 11 89,192,602 (GRCm39) missense probably damaging 0.99
R9722:Nog UTSW 11 89,192,396 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGAAATGATGGGGTACTGG -3'
(R):5'- CGGGCTTTATGGCTACTTCG -3'

Sequencing Primer
(F):5'- ATGGGGTACTGGATGGGAATCC -3'
(R):5'- TACTTCGCCCCCTGAGGAC -3'
Posted On 2017-02-10