Incidental Mutation 'R5864:Epha2'
ID454052
Institutional Source Beutler Lab
Gene Symbol Epha2
Ensembl Gene ENSMUSG00000006445
Gene NameEph receptor A2
SynonymsMyk2, Eck, Sek-2, Sek2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R5864 (G1)
Quality Score180
Status Not validated
Chromosome4
Chromosomal Location141301240-141329384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141308427 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 58 (M58K)
Ref Sequence ENSEMBL: ENSMUSP00000006614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006614]
Predicted Effect probably damaging
Transcript: ENSMUST00000006614
AA Change: M58K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: M58K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EPH_lbd 27 200 1.31e-112 SMART
FN3 330 420 1.16e-6 SMART
FN3 437 517 3.73e-10 SMART
Pfam:EphA2_TM 538 611 5.9e-22 PFAM
TyrKc 614 872 2.23e-135 SMART
SAM 902 969 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145523
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A T 12: 84,043,404 I292F probably benign Het
Adamdec1 A G 14: 68,570,102 S370P probably damaging Het
Ankar T C 1: 72,659,165 K692R probably benign Het
Ano6 T C 15: 95,920,380 probably null Het
Apopt1 G A 12: 111,751,218 V171I probably benign Het
Asns G A 6: 7,675,443 Q520* probably null Het
Bbs12 C T 3: 37,319,490 T144I probably damaging Het
BC030867 G A 11: 102,255,146 E83K probably benign Het
C8g C T 2: 25,498,943 G186D probably damaging Het
Clptm1l T C 13: 73,606,284 F109S probably damaging Het
Col4a1 G A 8: 11,202,973 probably benign Het
Cpn2 T C 16: 30,259,683 D400G probably damaging Het
Dgke G C 11: 89,050,462 Y298* probably null Het
Dnah5 G A 15: 28,297,013 R1451Q possibly damaging Het
Dock8 A G 19: 25,061,220 D90G probably damaging Het
Dok7 A C 5: 35,066,546 D143A probably damaging Het
Elk3 G A 10: 93,284,791 A62V probably damaging Het
Erp27 G T 6: 136,908,100 D233E probably benign Het
Gm5174 T A 10: 86,657,181 noncoding transcript Het
Gxylt2 A G 6: 100,783,146 D214G probably damaging Het
Ifi35 A T 11: 101,458,243 I238F probably damaging Het
Ighmbp2 T C 19: 3,261,467 T983A probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Lrp1 C A 10: 127,567,505 K2066N possibly damaging Het
Mansc1 T G 6: 134,610,853 probably null Het
Mapre3 T C 5: 30,863,238 F101S probably damaging Het
Mettl8 T C 2: 70,982,013 T58A probably benign Het
Mical1 G T 10: 41,486,068 R857L possibly damaging Het
Nacad T C 11: 6,600,581 D870G probably benign Het
Nectin1 A G 9: 43,791,310 D118G probably damaging Het
Nlrp2 A T 7: 5,322,381 L26Q probably damaging Het
Olfr512 A G 7: 108,713,464 D25G probably benign Het
Pamr1 T C 2: 102,634,348 S281P possibly damaging Het
Pcdhgc5 T A 18: 37,821,761 V696E probably damaging Het
Pde4d G T 13: 109,938,048 A396S probably benign Het
Pecam1 G T 11: 106,684,250 C510* probably null Het
Pga5 C T 19: 10,675,149 G76S probably damaging Het
Phldb3 A T 7: 24,624,146 H435L possibly damaging Het
Piezo1 T C 8: 122,486,373 R1884G possibly damaging Het
Ripk4 T C 16: 97,763,582 H43R probably damaging Het
Rtn3 A G 19: 7,435,111 V785A probably damaging Het
Safb2 A G 17: 56,566,491 probably benign Het
Sephs1 T C 2: 4,905,582 F288L probably damaging Het
Sez6l A G 5: 112,438,400 probably null Het
Siglece A G 7: 43,659,317 L204P probably damaging Het
Sis T C 3: 72,949,818 D380G probably damaging Het
Slamf9 G T 1: 172,476,466 R126L probably benign Het
Sorl1 A G 9: 42,092,373 L209P probably damaging Het
Sptbn1 A C 11: 30,145,925 I310S probably damaging Het
Tex52 A G 6: 128,379,682 T113A probably benign Het
Trav6-3 T A 14: 53,430,171 Y33* probably null Het
Vmn2r102 A G 17: 19,694,681 E836G possibly damaging Het
Wdsub1 C T 2: 59,878,475 C18Y probably damaging Het
Zfp341 C A 2: 154,643,554 H637N possibly damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zfp612 G A 8: 110,089,726 D522N probably damaging Het
Other mutations in Epha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Epha2 APN 4 141318524 missense probably damaging 1.00
IGL02812:Epha2 APN 4 141318919 splice site probably benign
IGL03377:Epha2 APN 4 141322412 missense probably benign 0.08
R0165:Epha2 UTSW 4 141321892 critical splice donor site probably null
R0321:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R1584:Epha2 UTSW 4 141322047 splice site probably null
R1586:Epha2 UTSW 4 141318605 splice site probably benign
R1695:Epha2 UTSW 4 141306517 missense possibly damaging 0.74
R1721:Epha2 UTSW 4 141322652 missense probably damaging 1.00
R1731:Epha2 UTSW 4 141321752 missense possibly damaging 0.81
R1813:Epha2 UTSW 4 141308546 missense possibly damaging 0.86
R1875:Epha2 UTSW 4 141308979 missense probably benign 0.02
R2226:Epha2 UTSW 4 141321237 missense probably damaging 1.00
R2314:Epha2 UTSW 4 141319014 missense probably damaging 1.00
R2342:Epha2 UTSW 4 141323531 missense probably benign 0.00
R3872:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R3927:Epha2 UTSW 4 141306550 missense probably damaging 1.00
R4688:Epha2 UTSW 4 141318981 missense probably benign
R4795:Epha2 UTSW 4 141322416 splice site probably null
R4974:Epha2 UTSW 4 141321705 missense probably damaging 0.99
R5055:Epha2 UTSW 4 141309069 missense probably benign 0.09
R5123:Epha2 UTSW 4 141308865 missense possibly damaging 0.71
R5424:Epha2 UTSW 4 141318940 nonsense probably null
R5522:Epha2 UTSW 4 141308556 missense probably damaging 1.00
R5657:Epha2 UTSW 4 141323494 missense probably damaging 1.00
R5717:Epha2 UTSW 4 141322071 missense probably benign
R6151:Epha2 UTSW 4 141318480 critical splice acceptor site probably null
R6244:Epha2 UTSW 4 141316912 missense probably benign 0.00
R6288:Epha2 UTSW 4 141317033 missense probably benign 0.01
R6696:Epha2 UTSW 4 141321539 missense probably benign
R6817:Epha2 UTSW 4 141308994 missense probably damaging 0.98
R6875:Epha2 UTSW 4 141328468 missense probably damaging 1.00
R6910:Epha2 UTSW 4 141321513 missense probably damaging 1.00
R6925:Epha2 UTSW 4 141308757 missense probably benign
R7330:Epha2 UTSW 4 141308453 missense probably benign 0.00
R7977:Epha2 UTSW 4 141308480 missense probably damaging 1.00
R7987:Epha2 UTSW 4 141308480 missense probably damaging 1.00
R8081:Epha2 UTSW 4 141322294 missense probably damaging 1.00
RF024:Epha2 UTSW 4 141323406 critical splice acceptor site unknown
Z1177:Epha2 UTSW 4 141318998 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCCCTGTAGAATGAAGGC -3'
(R):5'- GTCTCTTTGCATGAGCTGGC -3'

Sequencing Primer
(F):5'- TCCCTCAGGACACAGTGAGTTTG -3'
(R):5'- CATGAGCTGGCGCCACC -3'
Posted On2017-02-10