Mutagenetix > Incidental Mutation

Incidental Mutation 'R5864:Asns'

454056

Institutional Source

Beutler Lab

Gene Symbol

Asns

Ensembl Gene

ENSMUSG00000029752

Gene Name

asparagine synthetase

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R5864 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7675169-7693254 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 7675443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 520 (Q520*)

Ref Sequence

ENSEMBL: ENSMUSP00000111204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542]

AlphaFold

Q61024

Predicted Effect

probably null
Transcript: ENSMUST00000031766
AA Change: Q520*

SMART Domains

Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: Q520*

Domain	Start	End	E-Value	Type
Pfam:GATase_6	29	160	4.3e-21	PFAM
Pfam:GATase_7	47	166	9.1e-26	PFAM
Pfam:DUF3700	68	178	5.5e-6	PFAM
Pfam:GATase_2	91	161	3.3e-5	PFAM
Pfam:Asn_synthase	234	467	1.7e-61	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115542
AA Change: Q520*

SMART Domains

Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: Q520*

Domain	Start	End	E-Value	Type
Pfam:GATase_6	29	160	1.2e-19	PFAM
Pfam:GATase_7	47	166	4.8e-25	PFAM
Pfam:DUF3700	64	180	3.3e-6	PFAM
Pfam:Asn_synthase	234	390	2.4e-46	PFAM
Pfam:Asn_synthase	382	547	1.5e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140097

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot4	A	T	12: 84,043,404	I292F	probably benign	Het
Adamdec1	A	G	14: 68,570,102	S370P	probably damaging	Het
Ankar	T	C	1: 72,659,165	K692R	probably benign	Het
Ano6	T	C	15: 95,920,380		probably null	Het
Apopt1	G	A	12: 111,751,218	V171I	probably benign	Het
Bbs12	C	T	3: 37,319,490	T144I	probably damaging	Het
BC030867	G	A	11: 102,255,146	E83K	probably benign	Het
C8g	C	T	2: 25,498,943	G186D	probably damaging	Het
Clptm1l	T	C	13: 73,606,284	F109S	probably damaging	Het
Col4a1	G	A	8: 11,202,973		probably benign	Het
Cpn2	T	C	16: 30,259,683	D400G	probably damaging	Het
Dgke	G	C	11: 89,050,462	Y298*	probably null	Het
Dnah5	G	A	15: 28,297,013	R1451Q	possibly damaging	Het
Dock8	A	G	19: 25,061,220	D90G	probably damaging	Het
Dok7	A	C	5: 35,066,546	D143A	probably damaging	Het
Elk3	G	A	10: 93,284,791	A62V	probably damaging	Het
Epha2	T	A	4: 141,308,427	M58K	probably damaging	Het
Erp27	G	T	6: 136,908,100	D233E	probably benign	Het
Gm5174	T	A	10: 86,657,181		noncoding transcript	Het
Gxylt2	A	G	6: 100,783,146	D214G	probably damaging	Het
Ifi35	A	T	11: 101,458,243	I238F	probably damaging	Het
Ighmbp2	T	C	19: 3,261,467	T983A	probably benign	Het
Itgb4	C	T	11: 115,990,922	R766W	probably damaging	Het
Lrp1	C	A	10: 127,567,505	K2066N	possibly damaging	Het
Mansc1	T	G	6: 134,610,853		probably null	Het
Mapre3	T	C	5: 30,863,238	F101S	probably damaging	Het
Mettl8	T	C	2: 70,982,013	T58A	probably benign	Het
Mical1	G	T	10: 41,486,068	R857L	possibly damaging	Het
Nacad	T	C	11: 6,600,581	D870G	probably benign	Het
Nectin1	A	G	9: 43,791,310	D118G	probably damaging	Het
Nlrp2	A	T	7: 5,322,381	L26Q	probably damaging	Het
Olfr512	A	G	7: 108,713,464	D25G	probably benign	Het
Pamr1	T	C	2: 102,634,348	S281P	possibly damaging	Het
Pcdhgc5	T	A	18: 37,821,761	V696E	probably damaging	Het
Pde4d	G	T	13: 109,938,048	A396S	probably benign	Het
Pecam1	G	T	11: 106,684,250	C510*	probably null	Het
Pga5	C	T	19: 10,675,149	G76S	probably damaging	Het
Phldb3	A	T	7: 24,624,146	H435L	possibly damaging	Het
Piezo1	T	C	8: 122,486,373	R1884G	possibly damaging	Het
Ripk4	T	C	16: 97,763,582	H43R	probably damaging	Het
Rtn3	A	G	19: 7,435,111	V785A	probably damaging	Het
Safb2	A	G	17: 56,566,491		probably benign	Het
Sephs1	T	C	2: 4,905,582	F288L	probably damaging	Het
Sez6l	A	G	5: 112,438,400		probably null	Het
Siglece	A	G	7: 43,659,317	L204P	probably damaging	Het
Sis	T	C	3: 72,949,818	D380G	probably damaging	Het
Slamf9	G	T	1: 172,476,466	R126L	probably benign	Het
Sorl1	A	G	9: 42,092,373	L209P	probably damaging	Het
Sptbn1	A	C	11: 30,145,925	I310S	probably damaging	Het
Tex52	A	G	6: 128,379,682	T113A	probably benign	Het
Trav6-3	T	A	14: 53,430,171	Y33*	probably null	Het
Vmn2r102	A	G	17: 19,694,681	E836G	possibly damaging	Het
Wdsub1	C	T	2: 59,878,475	C18Y	probably damaging	Het
Zfp341	C	A	2: 154,643,554	H637N	possibly damaging	Het
Zfp445	C	T	9: 122,853,487	S463N	probably benign	Het
Zfp612	G	A	8: 110,089,726	D522N	probably damaging	Het

Other mutations in Asns

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Asns	APN	6	7680179	missense	probably damaging	1.00
IGL00656:Asns	APN	6	7680215	unclassified	probably benign
IGL01534:Asns	APN	6	7675397	missense	probably benign	0.03
IGL01996:Asns	APN	6	7682378	missense	possibly damaging	0.56
IGL02058:Asns	APN	6	7685184	missense	probably damaging	1.00
IGL02311:Asns	APN	6	7676233	critical splice donor site	probably null
IGL02367:Asns	APN	6	7685411	splice site	probably benign
IGL03263:Asns	APN	6	7689404	missense	probably benign	0.07
IGL03341:Asns	APN	6	7682002	missense	probably damaging	0.98
PIT4445001:Asns	UTSW	6	7689277	missense	probably damaging	1.00
R0034:Asns	UTSW	6	7676299	missense	probably damaging	1.00
R0034:Asns	UTSW	6	7676299	missense	probably damaging	1.00
R0050:Asns	UTSW	6	7676019	missense	probably benign	0.02
R0627:Asns	UTSW	6	7675516	missense	probably benign	0.05
R1075:Asns	UTSW	6	7676076	nonsense	probably null
R1591:Asns	UTSW	6	7678007	missense	probably damaging	0.97
R2047:Asns	UTSW	6	7680093	missense	probably damaging	0.99
R2232:Asns	UTSW	6	7689316	missense	possibly damaging	0.82
R2907:Asns	UTSW	6	7675506	missense	probably benign	0.03
R3907:Asns	UTSW	6	7682270	critical splice donor site	probably null
R4373:Asns	UTSW	6	7677978	missense	probably damaging	0.98
R4438:Asns	UTSW	6	7675320	missense	probably benign	0.15
R4660:Asns	UTSW	6	7678012	missense	probably benign	0.05
R4784:Asns	UTSW	6	7678029	missense	probably benign	0.12
R5655:Asns	UTSW	6	7685309	missense	probably benign	0.31
R5752:Asns	UTSW	6	7689365	missense	probably damaging	1.00
R5863:Asns	UTSW	6	7675443	nonsense	probably null
R5953:Asns	UTSW	6	7682285	missense	probably benign	0.00
R6773:Asns	UTSW	6	7676284	missense	probably benign	0.01
R6789:Asns	UTSW	6	7675344	missense	probably benign
R7389:Asns	UTSW	6	7689291	missense	probably damaging	1.00
R7524:Asns	UTSW	6	7677259	splice site	probably null
R7783:Asns	UTSW	6	7677978	missense	probably damaging	1.00
R7949:Asns	UTSW	6	7685328	missense	probably damaging	0.97
R8722:Asns	UTSW	6	7676085	missense	probably damaging	1.00
R9405:Asns	UTSW	6	7689283	missense	probably damaging	0.99
R9663:Asns	UTSW	6	7680132	missense	probably damaging	1.00
R9697:Asns	UTSW	6	7689268	missense	probably damaging	1.00
R9798:Asns	UTSW	6	7689395	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TGACTGATGGCTGAGTCTCATTC -3'
(R):5'- CGTAAAGGGTCTTGTTGCTTCATAG -3'

Sequencing Primer
(F):5'- GCTGTCTCGACCTTCAGAG -3'
(R):5'- TTTGGTCACCATCAGAGC -3'

Posted On

2017-02-10