Incidental Mutation 'R5864:Nlrp2'
ID454062
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene NameNLR family, pyrin domain containing 2
SynonymsNbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5864 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5298547-5351035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5322381 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 26 (L26Q)
Ref Sequence ENSEMBL: ENSMUSP00000147102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: L764Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: L764Q

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207520
AA Change: L26Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000207685
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A T 12: 84,043,404 I292F probably benign Het
Adamdec1 A G 14: 68,570,102 S370P probably damaging Het
Ankar T C 1: 72,659,165 K692R probably benign Het
Ano6 T C 15: 95,920,380 probably null Het
Apopt1 G A 12: 111,751,218 V171I probably benign Het
Asns G A 6: 7,675,443 Q520* probably null Het
Bbs12 C T 3: 37,319,490 T144I probably damaging Het
BC030867 G A 11: 102,255,146 E83K probably benign Het
C8g C T 2: 25,498,943 G186D probably damaging Het
Clptm1l T C 13: 73,606,284 F109S probably damaging Het
Col4a1 G A 8: 11,202,973 probably benign Het
Cpn2 T C 16: 30,259,683 D400G probably damaging Het
Dgke G C 11: 89,050,462 Y298* probably null Het
Dnah5 G A 15: 28,297,013 R1451Q possibly damaging Het
Dock8 A G 19: 25,061,220 D90G probably damaging Het
Dok7 A C 5: 35,066,546 D143A probably damaging Het
Elk3 G A 10: 93,284,791 A62V probably damaging Het
Epha2 T A 4: 141,308,427 M58K probably damaging Het
Erp27 G T 6: 136,908,100 D233E probably benign Het
Gm5174 T A 10: 86,657,181 noncoding transcript Het
Gxylt2 A G 6: 100,783,146 D214G probably damaging Het
Ifi35 A T 11: 101,458,243 I238F probably damaging Het
Ighmbp2 T C 19: 3,261,467 T983A probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Lrp1 C A 10: 127,567,505 K2066N possibly damaging Het
Mansc1 T G 6: 134,610,853 probably null Het
Mapre3 T C 5: 30,863,238 F101S probably damaging Het
Mettl8 T C 2: 70,982,013 T58A probably benign Het
Mical1 G T 10: 41,486,068 R857L possibly damaging Het
Nacad T C 11: 6,600,581 D870G probably benign Het
Nectin1 A G 9: 43,791,310 D118G probably damaging Het
Olfr512 A G 7: 108,713,464 D25G probably benign Het
Pamr1 T C 2: 102,634,348 S281P possibly damaging Het
Pcdhgc5 T A 18: 37,821,761 V696E probably damaging Het
Pde4d G T 13: 109,938,048 A396S probably benign Het
Pecam1 G T 11: 106,684,250 C510* probably null Het
Pga5 C T 19: 10,675,149 G76S probably damaging Het
Phldb3 A T 7: 24,624,146 H435L possibly damaging Het
Piezo1 T C 8: 122,486,373 R1884G possibly damaging Het
Ripk4 T C 16: 97,763,582 H43R probably damaging Het
Rtn3 A G 19: 7,435,111 V785A probably damaging Het
Safb2 A G 17: 56,566,491 probably benign Het
Sephs1 T C 2: 4,905,582 F288L probably damaging Het
Sez6l A G 5: 112,438,400 probably null Het
Siglece A G 7: 43,659,317 L204P probably damaging Het
Sis T C 3: 72,949,818 D380G probably damaging Het
Slamf9 G T 1: 172,476,466 R126L probably benign Het
Sorl1 A G 9: 42,092,373 L209P probably damaging Het
Sptbn1 A C 11: 30,145,925 I310S probably damaging Het
Tex52 A G 6: 128,379,682 T113A probably benign Het
Trav6-3 T A 14: 53,430,171 Y33* probably null Het
Vmn2r102 A G 17: 19,694,681 E836G possibly damaging Het
Wdsub1 C T 2: 59,878,475 C18Y probably damaging Het
Zfp341 C A 2: 154,643,554 H637N possibly damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zfp612 G A 8: 110,089,726 D522N probably damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5913:Nlrp2 UTSW 7 5324903 unclassified probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGGGTGAAGAACTCTGGGA -3'
(R):5'- CAAGCATACTGTCTCCCTTTGC -3'

Sequencing Primer
(F):5'- CTGGGAGGGGGCAACATTTG -3'
(R):5'- TAACTACATGGGTCCCTGGGATC -3'
Posted On2017-02-10