Incidental Mutation 'R5864:Nacad'
ID454076
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene NameNAC alpha domain containing
SynonymsmKIAA0363
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5864 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6597823-6606053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6600581 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 870 (D870G)
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000045713] [ENSMUST00000109721] [ENSMUST00000109722]
Predicted Effect probably benign
Transcript: ENSMUST00000000388
SMART Domains Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Blast:PTB 60 230 2e-35 BLAST
low complexity region 242 252 N/A INTRINSIC
Pfam:CCM2_C 296 396 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045713
AA Change: D870G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: D870G

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109721
SMART Domains Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109722
SMART Domains Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A T 12: 84,043,404 I292F probably benign Het
Adamdec1 A G 14: 68,570,102 S370P probably damaging Het
Ankar T C 1: 72,659,165 K692R probably benign Het
Ano6 T C 15: 95,920,380 probably null Het
Apopt1 G A 12: 111,751,218 V171I probably benign Het
Asns G A 6: 7,675,443 Q520* probably null Het
Bbs12 C T 3: 37,319,490 T144I probably damaging Het
BC030867 G A 11: 102,255,146 E83K probably benign Het
C8g C T 2: 25,498,943 G186D probably damaging Het
Clptm1l T C 13: 73,606,284 F109S probably damaging Het
Col4a1 G A 8: 11,202,973 probably benign Het
Cpn2 T C 16: 30,259,683 D400G probably damaging Het
Dgke G C 11: 89,050,462 Y298* probably null Het
Dnah5 G A 15: 28,297,013 R1451Q possibly damaging Het
Dock8 A G 19: 25,061,220 D90G probably damaging Het
Dok7 A C 5: 35,066,546 D143A probably damaging Het
Elk3 G A 10: 93,284,791 A62V probably damaging Het
Epha2 T A 4: 141,308,427 M58K probably damaging Het
Erp27 G T 6: 136,908,100 D233E probably benign Het
Gm5174 T A 10: 86,657,181 noncoding transcript Het
Gxylt2 A G 6: 100,783,146 D214G probably damaging Het
Ifi35 A T 11: 101,458,243 I238F probably damaging Het
Ighmbp2 T C 19: 3,261,467 T983A probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Lrp1 C A 10: 127,567,505 K2066N possibly damaging Het
Mansc1 T G 6: 134,610,853 probably null Het
Mapre3 T C 5: 30,863,238 F101S probably damaging Het
Mettl8 T C 2: 70,982,013 T58A probably benign Het
Mical1 G T 10: 41,486,068 R857L possibly damaging Het
Nectin1 A G 9: 43,791,310 D118G probably damaging Het
Nlrp2 A T 7: 5,322,381 L26Q probably damaging Het
Olfr512 A G 7: 108,713,464 D25G probably benign Het
Pamr1 T C 2: 102,634,348 S281P possibly damaging Het
Pcdhgc5 T A 18: 37,821,761 V696E probably damaging Het
Pde4d G T 13: 109,938,048 A396S probably benign Het
Pecam1 G T 11: 106,684,250 C510* probably null Het
Pga5 C T 19: 10,675,149 G76S probably damaging Het
Phldb3 A T 7: 24,624,146 H435L possibly damaging Het
Piezo1 T C 8: 122,486,373 R1884G possibly damaging Het
Ripk4 T C 16: 97,763,582 H43R probably damaging Het
Rtn3 A G 19: 7,435,111 V785A probably damaging Het
Safb2 A G 17: 56,566,491 probably benign Het
Sephs1 T C 2: 4,905,582 F288L probably damaging Het
Sez6l A G 5: 112,438,400 probably null Het
Siglece A G 7: 43,659,317 L204P probably damaging Het
Sis T C 3: 72,949,818 D380G probably damaging Het
Slamf9 G T 1: 172,476,466 R126L probably benign Het
Sorl1 A G 9: 42,092,373 L209P probably damaging Het
Sptbn1 A C 11: 30,145,925 I310S probably damaging Het
Tex52 A G 6: 128,379,682 T113A probably benign Het
Trav6-3 T A 14: 53,430,171 Y33* probably null Het
Vmn2r102 A G 17: 19,694,681 E836G possibly damaging Het
Wdsub1 C T 2: 59,878,475 C18Y probably damaging Het
Zfp341 C A 2: 154,643,554 H637N possibly damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zfp612 G A 8: 110,089,726 D522N probably damaging Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6600921 missense probably benign 0.24
IGL00903:Nacad APN 11 6600632 missense probably damaging 0.99
IGL01303:Nacad APN 11 6598279 missense possibly damaging 0.81
IGL01353:Nacad APN 11 6600530 missense possibly damaging 0.70
IGL01833:Nacad APN 11 6605700 missense unknown
IGL02267:Nacad APN 11 6602649 missense probably benign 0.14
IGL02531:Nacad APN 11 6598580 missense possibly damaging 0.90
IGL02994:Nacad APN 11 6599528 missense possibly damaging 0.83
IGL03121:Nacad APN 11 6600933 missense probably damaging 0.98
IGL03161:Nacad APN 11 6600378 nonsense probably null
FR4340:Nacad UTSW 11 6599761 small insertion probably benign
FR4342:Nacad UTSW 11 6599762 small insertion probably benign
FR4548:Nacad UTSW 11 6599752 small insertion probably benign
FR4548:Nacad UTSW 11 6599760 small insertion probably benign
FR4589:Nacad UTSW 11 6599753 small insertion probably benign
FR4976:Nacad UTSW 11 6599749 small insertion probably benign
FR4976:Nacad UTSW 11 6599756 small insertion probably benign
FR4976:Nacad UTSW 11 6599763 small insertion probably benign
PIT4402001:Nacad UTSW 11 6598621 missense probably benign 0.19
R0330:Nacad UTSW 11 6600903 missense probably benign
R0331:Nacad UTSW 11 6599441 missense possibly damaging 0.84
R0409:Nacad UTSW 11 6599810 missense probably benign 0.00
R0612:Nacad UTSW 11 6601382 missense possibly damaging 0.90
R0644:Nacad UTSW 11 6599486 missense possibly damaging 0.69
R0829:Nacad UTSW 11 6601158 missense probably benign 0.18
R1483:Nacad UTSW 11 6602217 missense probably damaging 0.99
R1583:Nacad UTSW 11 6601185 missense probably benign 0.08
R1905:Nacad UTSW 11 6602540 missense probably benign 0.15
R1907:Nacad UTSW 11 6602540 missense probably benign 0.15
R2361:Nacad UTSW 11 6600821 missense probably benign
R2979:Nacad UTSW 11 6601424 missense probably benign 0.06
R4192:Nacad UTSW 11 6605534 missense probably benign 0.44
R4381:Nacad UTSW 11 6600204 missense probably benign 0.18
R4539:Nacad UTSW 11 6600677 missense possibly damaging 0.94
R4751:Nacad UTSW 11 6605726 missense unknown
R4944:Nacad UTSW 11 6598507 missense possibly damaging 0.95
R4962:Nacad UTSW 11 6599169 missense probably damaging 1.00
R5102:Nacad UTSW 11 6598528 missense probably damaging 1.00
R5189:Nacad UTSW 11 6601611 missense probably damaging 0.98
R5296:Nacad UTSW 11 6605745 missense unknown
R5566:Nacad UTSW 11 6602136 missense probably damaging 1.00
R5634:Nacad UTSW 11 6602387 missense possibly damaging 0.88
R5725:Nacad UTSW 11 6601643 missense probably benign 0.15
R5748:Nacad UTSW 11 6598370 nonsense probably null
R5882:Nacad UTSW 11 6598568 missense possibly damaging 0.95
R6089:Nacad UTSW 11 6601331 missense probably benign 0.03
R6117:Nacad UTSW 11 6599810 missense probably benign 0.00
R6161:Nacad UTSW 11 6600902 missense probably benign
R6351:Nacad UTSW 11 6599235 missense probably damaging 1.00
R6351:Nacad UTSW 11 6600165 nonsense probably null
R6366:Nacad UTSW 11 6601196 missense probably benign 0.30
R6525:Nacad UTSW 11 6602255 missense probably damaging 1.00
R6811:Nacad UTSW 11 6599400 missense possibly damaging 0.66
R6931:Nacad UTSW 11 6601877 missense probably benign 0.14
R6966:Nacad UTSW 11 6602634 missense possibly damaging 0.93
R7228:Nacad UTSW 11 6598412 missense probably benign 0.19
R7248:Nacad UTSW 11 6598589 nonsense probably null
R7556:Nacad UTSW 11 6601272 missense possibly damaging 0.90
R7594:Nacad UTSW 11 6602457 missense probably damaging 0.99
R7813:Nacad UTSW 11 6599071 missense probably benign 0.38
R7841:Nacad UTSW 11 6601031 missense probably benign 0.00
R7924:Nacad UTSW 11 6601031 missense probably benign 0.00
T0975:Nacad UTSW 11 6599750 small insertion probably benign
T0975:Nacad UTSW 11 6601622 missense probably benign 0.03
T0975:Nacad UTSW 11 6601632 missense probably benign 0.17
X0011:Nacad UTSW 11 6601074 missense probably benign 0.00
Z1176:Nacad UTSW 11 6602297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTAACCTGGCTCTGAGC -3'
(R):5'- AAGCTCACATCCCACTTCGG -3'

Sequencing Primer
(F):5'- AGCCATTCTGTTGGGCC -3'
(R):5'- TTCGGACCAAGAACGCG -3'
Posted On2017-02-10