Mutagenetix > Incidental Mutation

Incidental Mutation 'R5864:Clptm1l'

454087

Institutional Source

Beutler Lab

Gene Symbol

Clptm1l

Ensembl Gene

ENSMUSG00000021610

Gene Name

CLPTM1-like

Synonyms

C130052I12Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5864 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73604006-73620605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73606284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 109 (F109S)

Ref Sequence

ENSEMBL: ENSMUSP00000022102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022102]

AlphaFold

Q8BXA5

Predicted Effect

probably damaging
Transcript: ENSMUST00000022102
AA Change: F109S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: F109S

Domain	Start	End	E-Value	Type
Pfam:CLPTM1	10	423	3.2e-134	PFAM
transmembrane domain	428	450	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot4	A	T	12: 84,043,404	I292F	probably benign	Het
Adamdec1	A	G	14: 68,570,102	S370P	probably damaging	Het
Ankar	T	C	1: 72,659,165	K692R	probably benign	Het
Ano6	T	C	15: 95,920,380		probably null	Het
Apopt1	G	A	12: 111,751,218	V171I	probably benign	Het
Asns	G	A	6: 7,675,443	Q520*	probably null	Het
Bbs12	C	T	3: 37,319,490	T144I	probably damaging	Het
BC030867	G	A	11: 102,255,146	E83K	probably benign	Het
C8g	C	T	2: 25,498,943	G186D	probably damaging	Het
Col4a1	G	A	8: 11,202,973		probably benign	Het
Cpn2	T	C	16: 30,259,683	D400G	probably damaging	Het
Dgke	G	C	11: 89,050,462	Y298*	probably null	Het
Dnah5	G	A	15: 28,297,013	R1451Q	possibly damaging	Het
Dock8	A	G	19: 25,061,220	D90G	probably damaging	Het
Dok7	A	C	5: 35,066,546	D143A	probably damaging	Het
Elk3	G	A	10: 93,284,791	A62V	probably damaging	Het
Epha2	T	A	4: 141,308,427	M58K	probably damaging	Het
Erp27	G	T	6: 136,908,100	D233E	probably benign	Het
Gm5174	T	A	10: 86,657,181		noncoding transcript	Het
Gxylt2	A	G	6: 100,783,146	D214G	probably damaging	Het
Ifi35	A	T	11: 101,458,243	I238F	probably damaging	Het
Ighmbp2	T	C	19: 3,261,467	T983A	probably benign	Het
Itgb4	C	T	11: 115,990,922	R766W	probably damaging	Het
Lrp1	C	A	10: 127,567,505	K2066N	possibly damaging	Het
Mansc1	T	G	6: 134,610,853		probably null	Het
Mapre3	T	C	5: 30,863,238	F101S	probably damaging	Het
Mettl8	T	C	2: 70,982,013	T58A	probably benign	Het
Mical1	G	T	10: 41,486,068	R857L	possibly damaging	Het
Nacad	T	C	11: 6,600,581	D870G	probably benign	Het
Nectin1	A	G	9: 43,791,310	D118G	probably damaging	Het
Nlrp2	A	T	7: 5,322,381	L26Q	probably damaging	Het
Olfr512	A	G	7: 108,713,464	D25G	probably benign	Het
Pamr1	T	C	2: 102,634,348	S281P	possibly damaging	Het
Pcdhgc5	T	A	18: 37,821,761	V696E	probably damaging	Het
Pde4d	G	T	13: 109,938,048	A396S	probably benign	Het
Pecam1	G	T	11: 106,684,250	C510*	probably null	Het
Pga5	C	T	19: 10,675,149	G76S	probably damaging	Het
Phldb3	A	T	7: 24,624,146	H435L	possibly damaging	Het
Piezo1	T	C	8: 122,486,373	R1884G	possibly damaging	Het
Ripk4	T	C	16: 97,763,582	H43R	probably damaging	Het
Rtn3	A	G	19: 7,435,111	V785A	probably damaging	Het
Safb2	A	G	17: 56,566,491		probably benign	Het
Sephs1	T	C	2: 4,905,582	F288L	probably damaging	Het
Sez6l	A	G	5: 112,438,400		probably null	Het
Siglece	A	G	7: 43,659,317	L204P	probably damaging	Het
Sis	T	C	3: 72,949,818	D380G	probably damaging	Het
Slamf9	G	T	1: 172,476,466	R126L	probably benign	Het
Sorl1	A	G	9: 42,092,373	L209P	probably damaging	Het
Sptbn1	A	C	11: 30,145,925	I310S	probably damaging	Het
Tex52	A	G	6: 128,379,682	T113A	probably benign	Het
Trav6-3	T	A	14: 53,430,171	Y33*	probably null	Het
Vmn2r102	A	G	17: 19,694,681	E836G	possibly damaging	Het
Wdsub1	C	T	2: 59,878,475	C18Y	probably damaging	Het
Zfp341	C	A	2: 154,643,554	H637N	possibly damaging	Het
Zfp445	C	T	9: 122,853,487	S463N	probably benign	Het
Zfp612	G	A	8: 110,089,726	D522N	probably damaging	Het

Other mutations in Clptm1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01672:Clptm1l	APN	13	73607873	splice site	probably null
IGL01963:Clptm1l	APN	13	73617569	splice site	probably benign
IGL02169:Clptm1l	APN	13	73611663	missense	probably damaging	0.96
IGL02554:Clptm1l	APN	13	73607760	missense	probably benign	0.07
IGL02596:Clptm1l	APN	13	73613666	missense	probably benign	0.02
IGL02720:Clptm1l	APN	13	73614602	splice site	probably benign
IGL03100:Clptm1l	APN	13	73612390	splice site	probably benign
P0023:Clptm1l	UTSW	13	73604952	missense	possibly damaging	0.67
R0308:Clptm1l	UTSW	13	73611667	missense	possibly damaging	0.67
R0725:Clptm1l	UTSW	13	73606343	missense	probably benign
R1572:Clptm1l	UTSW	13	73607747	missense	probably benign
R1589:Clptm1l	UTSW	13	73614673	critical splice donor site	probably null
R2062:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2064:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2065:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2067:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2068:Clptm1l	UTSW	13	73607723	nonsense	probably null
R3003:Clptm1l	UTSW	13	73617756	missense	possibly damaging	0.51
R3712:Clptm1l	UTSW	13	73616038	missense	probably benign	0.21
R3808:Clptm1l	UTSW	13	73612454	missense	probably benign	0.13
R3966:Clptm1l	UTSW	13	73615972	missense	probably damaging	1.00
R4615:Clptm1l	UTSW	13	73607738	nonsense	probably null
R4801:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4802:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4957:Clptm1l	UTSW	13	73611196	missense	possibly damaging	0.52
R4957:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R6502:Clptm1l	UTSW	13	73617765	critical splice donor site	probably null
R6701:Clptm1l	UTSW	13	73608906	missense	probably benign	0.00
R6720:Clptm1l	UTSW	13	73618516	missense	probably damaging	1.00
R7782:Clptm1l	UTSW	13	73604320	missense	probably damaging	1.00
R8292:Clptm1l	UTSW	13	73617735	missense	probably damaging	0.96
R8329:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R9224:Clptm1l	UTSW	13	73604225	start gained	probably benign
R9528:Clptm1l	UTSW	13	73612431	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- TCACAAGGCAGGTGGGTTTC -3'
(R):5'- AGCTGACATTAGAAGACATGCAC -3'

Sequencing Primer
(F):5'- TTAATCCCAGCTCCTTGGGAAG -3'
(R):5'- TTAGAAGACATGCACATAAACTCTG -3'

Posted On

2017-02-10