Mutagenetix > Incidental Mutation

Incidental Mutation 'R5864:Adamdec1'

454090

Institutional Source

Beutler Lab

Gene Symbol

Adamdec1

Ensembl Gene

ENSMUSG00000022057

Gene Name

ADAM-like, decysin 1

Synonyms

2210414L24Rik, Dcsn

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R5864 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68563380-68582095 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68570102 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 370 (S370P)

Ref Sequence

ENSEMBL: ENSMUSP00000022641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022641]

AlphaFold

Q9R0X2

Predicted Effect

probably damaging
Transcript: ENSMUST00000022641
AA Change: S370P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057
AA Change: S370P

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	37	175	3.9e-29	PFAM
Pfam:Reprolysin_5	215	389	9.8e-17	PFAM
Pfam:Reprolysin_4	216	407	7.3e-12	PFAM
Pfam:Reprolysin	217	411	1.5e-57	PFAM
Pfam:Reprolysin_3	242	360	1e-11	PFAM
DISIN	427	465	1.12e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot4	A	T	12: 84,043,404	I292F	probably benign	Het
Ankar	T	C	1: 72,659,165	K692R	probably benign	Het
Ano6	T	C	15: 95,920,380		probably null	Het
Apopt1	G	A	12: 111,751,218	V171I	probably benign	Het
Asns	G	A	6: 7,675,443	Q520*	probably null	Het
Bbs12	C	T	3: 37,319,490	T144I	probably damaging	Het
BC030867	G	A	11: 102,255,146	E83K	probably benign	Het
C8g	C	T	2: 25,498,943	G186D	probably damaging	Het
Clptm1l	T	C	13: 73,606,284	F109S	probably damaging	Het
Col4a1	G	A	8: 11,202,973		probably benign	Het
Cpn2	T	C	16: 30,259,683	D400G	probably damaging	Het
Dgke	G	C	11: 89,050,462	Y298*	probably null	Het
Dnah5	G	A	15: 28,297,013	R1451Q	possibly damaging	Het
Dock8	A	G	19: 25,061,220	D90G	probably damaging	Het
Dok7	A	C	5: 35,066,546	D143A	probably damaging	Het
Elk3	G	A	10: 93,284,791	A62V	probably damaging	Het
Epha2	T	A	4: 141,308,427	M58K	probably damaging	Het
Erp27	G	T	6: 136,908,100	D233E	probably benign	Het
Gm5174	T	A	10: 86,657,181		noncoding transcript	Het
Gxylt2	A	G	6: 100,783,146	D214G	probably damaging	Het
Ifi35	A	T	11: 101,458,243	I238F	probably damaging	Het
Ighmbp2	T	C	19: 3,261,467	T983A	probably benign	Het
Itgb4	C	T	11: 115,990,922	R766W	probably damaging	Het
Lrp1	C	A	10: 127,567,505	K2066N	possibly damaging	Het
Mansc1	T	G	6: 134,610,853		probably null	Het
Mapre3	T	C	5: 30,863,238	F101S	probably damaging	Het
Mettl8	T	C	2: 70,982,013	T58A	probably benign	Het
Mical1	G	T	10: 41,486,068	R857L	possibly damaging	Het
Nacad	T	C	11: 6,600,581	D870G	probably benign	Het
Nectin1	A	G	9: 43,791,310	D118G	probably damaging	Het
Nlrp2	A	T	7: 5,322,381	L26Q	probably damaging	Het
Olfr512	A	G	7: 108,713,464	D25G	probably benign	Het
Pamr1	T	C	2: 102,634,348	S281P	possibly damaging	Het
Pcdhgc5	T	A	18: 37,821,761	V696E	probably damaging	Het
Pde4d	G	T	13: 109,938,048	A396S	probably benign	Het
Pecam1	G	T	11: 106,684,250	C510*	probably null	Het
Pga5	C	T	19: 10,675,149	G76S	probably damaging	Het
Phldb3	A	T	7: 24,624,146	H435L	possibly damaging	Het
Piezo1	T	C	8: 122,486,373	R1884G	possibly damaging	Het
Ripk4	T	C	16: 97,763,582	H43R	probably damaging	Het
Rtn3	A	G	19: 7,435,111	V785A	probably damaging	Het
Safb2	A	G	17: 56,566,491		probably benign	Het
Sephs1	T	C	2: 4,905,582	F288L	probably damaging	Het
Sez6l	A	G	5: 112,438,400		probably null	Het
Siglece	A	G	7: 43,659,317	L204P	probably damaging	Het
Sis	T	C	3: 72,949,818	D380G	probably damaging	Het
Slamf9	G	T	1: 172,476,466	R126L	probably benign	Het
Sorl1	A	G	9: 42,092,373	L209P	probably damaging	Het
Sptbn1	A	C	11: 30,145,925	I310S	probably damaging	Het
Tex52	A	G	6: 128,379,682	T113A	probably benign	Het
Trav6-3	T	A	14: 53,430,171	Y33*	probably null	Het
Vmn2r102	A	G	17: 19,694,681	E836G	possibly damaging	Het
Wdsub1	C	T	2: 59,878,475	C18Y	probably damaging	Het
Zfp341	C	A	2: 154,643,554	H637N	possibly damaging	Het
Zfp445	C	T	9: 122,853,487	S463N	probably benign	Het
Zfp612	G	A	8: 110,089,726	D522N	probably damaging	Het

Other mutations in Adamdec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Adamdec1	APN	14	68573107	missense	probably damaging	1.00
IGL02026:Adamdec1	APN	14	68571802	missense	possibly damaging	0.81
IGL02068:Adamdec1	APN	14	68577109	missense	probably benign	0.21
IGL02416:Adamdec1	APN	14	68572833	missense	probably null	0.99
IGL02739:Adamdec1	APN	14	68570156	nonsense	probably null
IGL03078:Adamdec1	APN	14	68568850	missense	possibly damaging	0.53
IGL03115:Adamdec1	APN	14	68571353	missense	probably damaging	1.00
R0201:Adamdec1	UTSW	14	68581957	critical splice donor site	probably null
R0243:Adamdec1	UTSW	14	68581958	critical splice donor site	probably null
R0244:Adamdec1	UTSW	14	68568723	nonsense	probably null
R0416:Adamdec1	UTSW	14	68568712	missense	possibly damaging	0.79
R1373:Adamdec1	UTSW	14	68570951	missense	probably damaging	1.00
R1856:Adamdec1	UTSW	14	68570948	missense	probably damaging	1.00
R2570:Adamdec1	UTSW	14	68579208	missense	probably damaging	0.98
R3684:Adamdec1	UTSW	14	68581998	missense	probably benign	0.04
R3755:Adamdec1	UTSW	14	68577138	missense	probably damaging	1.00
R4450:Adamdec1	UTSW	14	68573119	missense	probably benign	0.00
R4661:Adamdec1	UTSW	14	68570113	missense	probably damaging	1.00
R4672:Adamdec1	UTSW	14	68577904	nonsense	probably null
R4673:Adamdec1	UTSW	14	68577904	nonsense	probably null
R4902:Adamdec1	UTSW	14	68571766	missense	probably damaging	0.99
R5017:Adamdec1	UTSW	14	68573245	missense	probably benign	0.01
R5018:Adamdec1	UTSW	14	68571779	missense	probably damaging	1.00
R5141:Adamdec1	UTSW	14	68573128	missense	probably benign	0.00
R5329:Adamdec1	UTSW	14	68570163	missense	probably damaging	1.00
R5395:Adamdec1	UTSW	14	68570903	missense	probably benign	0.04
R6032:Adamdec1	UTSW	14	68579184	missense	probably damaging	1.00
R6032:Adamdec1	UTSW	14	68579184	missense	probably damaging	1.00
R6114:Adamdec1	UTSW	14	68571803	missense	probably benign	0.00
R6633:Adamdec1	UTSW	14	68573152	missense	probably benign	0.03
R7243:Adamdec1	UTSW	14	68571754	missense	probably benign	0.06
R7580:Adamdec1	UTSW	14	68565531	missense	probably benign	0.00
R8388:Adamdec1	UTSW	14	68573235	nonsense	probably null
R9133:Adamdec1	UTSW	14	68577098	nonsense	probably null
X0025:Adamdec1	UTSW	14	68570158	missense	probably damaging	1.00
X0050:Adamdec1	UTSW	14	68570158	missense	probably damaging	1.00
X0062:Adamdec1	UTSW	14	68573252	missense	probably benign	0.12
Z1177:Adamdec1	UTSW	14	68580643	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCATGAGTCTTGAATTTGGC -3'
(R):5'- TCATAGGAGCCAGTCATACCAGG -3'

Sequencing Primer
(F):5'- CATGAGTCTTGAATTTGGCAAAATAC -3'
(R):5'- GATGTCACATGAGTTGGG -3'

Posted On

2017-02-10