Incidental Mutation 'R5865:Fam171a1'
ID454105
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Namefamily with sequence similarity 171, member A1
Synonyms
MMRRC Submission 044074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5865 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3114224-3227806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3225337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 377 (D377E)
Ref Sequence ENSEMBL: ENSMUSP00000072724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: D497E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: D497E

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: D377E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: D377E

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: D502E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: D502E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.7%
  • 20x: 88.7%
Validation Efficiency 91% (59/65)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,712,128 V48M possibly damaging Het
Adamts2 T G 11: 50,803,954 Y1189* probably null Het
Bpifb9a T C 2: 154,266,836 I419T probably benign Het
Ccbe1 A T 18: 66,083,151 I167N possibly damaging Het
Ccdc187 T C 2: 26,293,368 T207A probably benign Het
Cd300lf G A 11: 115,126,300 L66F probably damaging Het
Cenpk A G 13: 104,236,194 *92W probably null Het
Col12a1 A T 9: 79,604,478 S2950R probably benign Het
Dnah3 T C 7: 119,975,108 T2154A probably benign Het
Ebna1bp2 A T 4: 118,621,135 probably benign Het
Elac2 G T 11: 64,997,957 C532F probably benign Het
Haus6 A G 4: 86,586,357 C466R possibly damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kank4 T C 4: 98,771,393 Y816C possibly damaging Het
Kcnc4 A T 3: 107,458,199 probably null Het
Kif21b C T 1: 136,151,137 R408* probably null Het
Lrrc31 A G 3: 30,679,140 V475A probably benign Het
Map2k1 C T 9: 64,191,266 probably null Het
Mc3r T A 2: 172,249,672 N271K possibly damaging Het
Ms4a14 A G 19: 11,304,217 S326P possibly damaging Het
Muc6 T A 7: 141,650,504 I358F probably damaging Het
Myo5c A G 9: 75,297,488 D1541G probably damaging Het
Myof T C 19: 37,910,934 S1793G probably damaging Het
Nfkb1 T A 3: 135,603,780 T518S probably damaging Het
Nphs1 T A 7: 30,474,385 I989N probably damaging Het
Olfr1024 T C 2: 85,904,521 T178A probably benign Het
Pcdha5 T C 18: 36,961,421 F328L probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Peg10 A G 6: 4,754,375 N52S probably damaging Het
Phf10 A C 17: 14,955,010 probably benign Het
Psme4 T C 11: 30,791,993 I152T possibly damaging Het
Ptpn18 T A 1: 34,471,563 probably benign Het
Rufy4 A T 1: 74,146,755 Y527F probably damaging Het
Snx32 T C 19: 5,496,354 M293V probably benign Het
Sorl1 A T 9: 41,983,034 L1827M possibly damaging Het
Sstr5 T A 17: 25,491,244 D337V probably benign Het
Tcaf3 A G 6: 42,596,697 F194L probably benign Het
Tcerg1 T A 18: 42,536,348 W459R probably damaging Het
Tet2 T A 3: 133,487,099 I525L probably benign Het
Tmem55b A G 14: 50,928,875 probably benign Het
Trim43b C T 9: 89,085,606 V325I probably benign Het
Txndc11 A T 16: 11,122,688 I180K probably damaging Het
Vmn1r193 A G 13: 22,219,225 L199P probably damaging Het
Vmn2r110 A G 17: 20,584,295 M121T probably benign Het
Zfhx4 G C 3: 5,402,659 A2626P probably damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zwilch T A 9: 64,172,908 probably null Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGCTGTCCCACAAAGAAGAGG -3'
(R):5'- ACTACAGCAGATCAACTGGC -3'

Sequencing Primer
(F):5'- GAGGATAAAAGCCAAACATCTTTTG -3'
(R):5'- AGCAGATCAACTGGCCTGGC -3'
Posted On2017-02-10