Incidental Mutation 'R5865:Ccdc187'
ID454106
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Namecoiled-coil domain containing 187
Synonyms4932418E24Rik
MMRRC Submission 044074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5865 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26243469-26294557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26293368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 207 (T207A)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
Predicted Effect probably benign
Transcript: ENSMUST00000057224
AA Change: T207A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: T207A

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: T207A
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: T207A
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.7%
  • 20x: 88.7%
Validation Efficiency 91% (59/65)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,712,128 V48M possibly damaging Het
Adamts2 T G 11: 50,803,954 Y1189* probably null Het
Bpifb9a T C 2: 154,266,836 I419T probably benign Het
Ccbe1 A T 18: 66,083,151 I167N possibly damaging Het
Cd300lf G A 11: 115,126,300 L66F probably damaging Het
Cenpk A G 13: 104,236,194 *92W probably null Het
Col12a1 A T 9: 79,604,478 S2950R probably benign Het
Dnah3 T C 7: 119,975,108 T2154A probably benign Het
Ebna1bp2 A T 4: 118,621,135 probably benign Het
Elac2 G T 11: 64,997,957 C532F probably benign Het
Fam171a1 T A 2: 3,225,337 D377E probably benign Het
Haus6 A G 4: 86,586,357 C466R possibly damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kank4 T C 4: 98,771,393 Y816C possibly damaging Het
Kcnc4 A T 3: 107,458,199 probably null Het
Kif21b C T 1: 136,151,137 R408* probably null Het
Lrrc31 A G 3: 30,679,140 V475A probably benign Het
Map2k1 C T 9: 64,191,266 probably null Het
Mc3r T A 2: 172,249,672 N271K possibly damaging Het
Ms4a14 A G 19: 11,304,217 S326P possibly damaging Het
Muc6 T A 7: 141,650,504 I358F probably damaging Het
Myo5c A G 9: 75,297,488 D1541G probably damaging Het
Myof T C 19: 37,910,934 S1793G probably damaging Het
Nfkb1 T A 3: 135,603,780 T518S probably damaging Het
Nphs1 T A 7: 30,474,385 I989N probably damaging Het
Olfr1024 T C 2: 85,904,521 T178A probably benign Het
Pcdha5 T C 18: 36,961,421 F328L probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Peg10 A G 6: 4,754,375 N52S probably damaging Het
Phf10 A C 17: 14,955,010 probably benign Het
Psme4 T C 11: 30,791,993 I152T possibly damaging Het
Ptpn18 T A 1: 34,471,563 probably benign Het
Rufy4 A T 1: 74,146,755 Y527F probably damaging Het
Snx32 T C 19: 5,496,354 M293V probably benign Het
Sorl1 A T 9: 41,983,034 L1827M possibly damaging Het
Sstr5 T A 17: 25,491,244 D337V probably benign Het
Tcaf3 A G 6: 42,596,697 F194L probably benign Het
Tcerg1 T A 18: 42,536,348 W459R probably damaging Het
Tet2 T A 3: 133,487,099 I525L probably benign Het
Tmem55b A G 14: 50,928,875 probably benign Het
Trim43b C T 9: 89,085,606 V325I probably benign Het
Txndc11 A T 16: 11,122,688 I180K probably damaging Het
Vmn1r193 A G 13: 22,219,225 L199P probably damaging Het
Vmn2r110 A G 17: 20,584,295 M121T probably benign Het
Zfhx4 G C 3: 5,402,659 A2626P probably damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zwilch T A 9: 64,172,908 probably null Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATCTTCACCCTAAATTCAGCTCAGAAG -3'
(R):5'- TTTCTCATGGGCCCTGGAAG -3'

Sequencing Primer
(F):5'- GCTCAGAAGCCCCACCC -3'
(R):5'- GGAAAGGCCACCCCTGATACTG -3'
Posted On2017-02-10