Incidental Mutation 'R5865:Lrrc31'
ID454111
Institutional Source Beutler Lab
Gene Symbol Lrrc31
Ensembl Gene ENSMUSG00000074653
Gene Nameleucine rich repeat containing 31
Synonyms
MMRRC Submission 044074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5865 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30679058-30699843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30679140 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 475 (V475A)
Ref Sequence ENSEMBL: ENSMUSP00000120802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108263] [ENSMUST00000126658]
Predicted Effect probably benign
Transcript: ENSMUST00000108263
SMART Domains Protein: ENSMUSP00000103898
Gene: ENSMUSG00000074653

DomainStartEndE-ValueType
LRR 92 119 4.5e-2 SMART
Blast:LRR 148 175 1e-8 BLAST
LRR 176 203 2.6e-1 SMART
LRR 204 231 6.7e-2 SMART
LRR 260 287 1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126658
AA Change: V475A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120802
Gene: ENSMUSG00000074653
AA Change: V475A

DomainStartEndE-ValueType
LRR 92 119 4.4e-2 SMART
Blast:LRR 148 175 2e-8 BLAST
LRR 176 203 2.5e-1 SMART
LRR 204 231 6.5e-2 SMART
LRR 260 287 9.9e-2 SMART
Pfam:LRR_6 288 307 8.2e-1 PFAM
LRR 372 399 8e-3 SMART
LRR 402 430 2.7e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.7%
  • 20x: 88.7%
Validation Efficiency 91% (59/65)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,712,128 V48M possibly damaging Het
Adamts2 T G 11: 50,803,954 Y1189* probably null Het
Bpifb9a T C 2: 154,266,836 I419T probably benign Het
Ccbe1 A T 18: 66,083,151 I167N possibly damaging Het
Ccdc187 T C 2: 26,293,368 T207A probably benign Het
Cd300lf G A 11: 115,126,300 L66F probably damaging Het
Cenpk A G 13: 104,236,194 *92W probably null Het
Col12a1 A T 9: 79,604,478 S2950R probably benign Het
Dnah3 T C 7: 119,975,108 T2154A probably benign Het
Ebna1bp2 A T 4: 118,621,135 probably benign Het
Elac2 G T 11: 64,997,957 C532F probably benign Het
Fam171a1 T A 2: 3,225,337 D377E probably benign Het
Haus6 A G 4: 86,586,357 C466R possibly damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kank4 T C 4: 98,771,393 Y816C possibly damaging Het
Kcnc4 A T 3: 107,458,199 probably null Het
Kif21b C T 1: 136,151,137 R408* probably null Het
Map2k1 C T 9: 64,191,266 probably null Het
Mc3r T A 2: 172,249,672 N271K possibly damaging Het
Ms4a14 A G 19: 11,304,217 S326P possibly damaging Het
Muc6 T A 7: 141,650,504 I358F probably damaging Het
Myo5c A G 9: 75,297,488 D1541G probably damaging Het
Myof T C 19: 37,910,934 S1793G probably damaging Het
Nfkb1 T A 3: 135,603,780 T518S probably damaging Het
Nphs1 T A 7: 30,474,385 I989N probably damaging Het
Olfr1024 T C 2: 85,904,521 T178A probably benign Het
Pcdha5 T C 18: 36,961,421 F328L probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Peg10 A G 6: 4,754,375 N52S probably damaging Het
Phf10 A C 17: 14,955,010 probably benign Het
Psme4 T C 11: 30,791,993 I152T possibly damaging Het
Ptpn18 T A 1: 34,471,563 probably benign Het
Rufy4 A T 1: 74,146,755 Y527F probably damaging Het
Snx32 T C 19: 5,496,354 M293V probably benign Het
Sorl1 A T 9: 41,983,034 L1827M possibly damaging Het
Sstr5 T A 17: 25,491,244 D337V probably benign Het
Tcaf3 A G 6: 42,596,697 F194L probably benign Het
Tcerg1 T A 18: 42,536,348 W459R probably damaging Het
Tet2 T A 3: 133,487,099 I525L probably benign Het
Tmem55b A G 14: 50,928,875 probably benign Het
Trim43b C T 9: 89,085,606 V325I probably benign Het
Txndc11 A T 16: 11,122,688 I180K probably damaging Het
Vmn1r193 A G 13: 22,219,225 L199P probably damaging Het
Vmn2r110 A G 17: 20,584,295 M121T probably benign Het
Zfhx4 G C 3: 5,402,659 A2626P probably damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zwilch T A 9: 64,172,908 probably null Het
Other mutations in Lrrc31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03110:Lrrc31 APN 3 30679266 missense probably benign 0.04
R0285:Lrrc31 UTSW 3 30684948 missense probably benign 0.02
R0348:Lrrc31 UTSW 3 30689228 missense probably benign 0.14
R0418:Lrrc31 UTSW 3 30689234 missense probably damaging 1.00
R0453:Lrrc31 UTSW 3 30687525 missense probably damaging 1.00
R0613:Lrrc31 UTSW 3 30685035 splice site probably benign
R2243:Lrrc31 UTSW 3 30685030 splice site probably benign
R2248:Lrrc31 UTSW 3 30689901 missense possibly damaging 0.95
R4093:Lrrc31 UTSW 3 30695522 missense probably damaging 1.00
R4781:Lrrc31 UTSW 3 30687377 intron probably benign
R4805:Lrrc31 UTSW 3 30691297 nonsense probably null
R4835:Lrrc31 UTSW 3 30679157 missense probably damaging 0.97
R4893:Lrrc31 UTSW 3 30679297 missense probably benign 0.02
R4936:Lrrc31 UTSW 3 30689268 missense probably damaging 1.00
R5063:Lrrc31 UTSW 3 30689936 missense possibly damaging 0.78
R5135:Lrrc31 UTSW 3 30684890 nonsense probably null
R5527:Lrrc31 UTSW 3 30691228 missense probably damaging 1.00
R5607:Lrrc31 UTSW 3 30689845 splice site probably null
R5608:Lrrc31 UTSW 3 30689845 splice site probably null
R5611:Lrrc31 UTSW 3 30691155 critical splice donor site probably null
R6001:Lrrc31 UTSW 3 30691169 missense possibly damaging 0.68
R7583:Lrrc31 UTSW 3 30691099 intron probably null
X0027:Lrrc31 UTSW 3 30689279 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCTACTAAACAACTACAGGCTGAG -3'
(R):5'- AGCGACACTACAGAAGCTTG -3'

Sequencing Primer
(F):5'- AACTACAGGCTGAGCACAG -3'
(R):5'- CCTGAGCTACAATGACGGTATCTG -3'
Posted On2017-02-10