Incidental Mutation 'R5865:Nphs1'
ID454121
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Namenephrosis 1, nephrin
Synonymsnephrin
MMRRC Submission 044074-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5865 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30458315-30487223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30474385 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 989 (I989N)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: I989N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: I989N

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123880
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: I975N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: I975N

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149086
Meta Mutation Damage Score 0.9239 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.7%
  • 20x: 88.7%
Validation Efficiency 91% (59/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,712,128 V48M possibly damaging Het
Adamts2 T G 11: 50,803,954 Y1189* probably null Het
Bpifb9a T C 2: 154,266,836 I419T probably benign Het
Ccbe1 A T 18: 66,083,151 I167N possibly damaging Het
Ccdc187 T C 2: 26,293,368 T207A probably benign Het
Cd300lf G A 11: 115,126,300 L66F probably damaging Het
Cenpk A G 13: 104,236,194 *92W probably null Het
Col12a1 A T 9: 79,604,478 S2950R probably benign Het
Dnah3 T C 7: 119,975,108 T2154A probably benign Het
Ebna1bp2 A T 4: 118,621,135 probably benign Het
Elac2 G T 11: 64,997,957 C532F probably benign Het
Fam171a1 T A 2: 3,225,337 D377E probably benign Het
Haus6 A G 4: 86,586,357 C466R possibly damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kank4 T C 4: 98,771,393 Y816C possibly damaging Het
Kcnc4 A T 3: 107,458,199 probably null Het
Kif21b C T 1: 136,151,137 R408* probably null Het
Lrrc31 A G 3: 30,679,140 V475A probably benign Het
Map2k1 C T 9: 64,191,266 probably null Het
Mc3r T A 2: 172,249,672 N271K possibly damaging Het
Ms4a14 A G 19: 11,304,217 S326P possibly damaging Het
Muc6 T A 7: 141,650,504 I358F probably damaging Het
Myo5c A G 9: 75,297,488 D1541G probably damaging Het
Myof T C 19: 37,910,934 S1793G probably damaging Het
Nfkb1 T A 3: 135,603,780 T518S probably damaging Het
Olfr1024 T C 2: 85,904,521 T178A probably benign Het
Pcdha5 T C 18: 36,961,421 F328L probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Peg10 A G 6: 4,754,375 N52S probably damaging Het
Phf10 A C 17: 14,955,010 probably benign Het
Psme4 T C 11: 30,791,993 I152T possibly damaging Het
Ptpn18 T A 1: 34,471,563 probably benign Het
Rufy4 A T 1: 74,146,755 Y527F probably damaging Het
Snx32 T C 19: 5,496,354 M293V probably benign Het
Sorl1 A T 9: 41,983,034 L1827M possibly damaging Het
Sstr5 T A 17: 25,491,244 D337V probably benign Het
Tcaf3 A G 6: 42,596,697 F194L probably benign Het
Tcerg1 T A 18: 42,536,348 W459R probably damaging Het
Tet2 T A 3: 133,487,099 I525L probably benign Het
Tmem55b A G 14: 50,928,875 probably benign Het
Trim43b C T 9: 89,085,606 V325I probably benign Het
Txndc11 A T 16: 11,122,688 I180K probably damaging Het
Vmn1r193 A G 13: 22,219,225 L199P probably damaging Het
Vmn2r110 A G 17: 20,584,295 M121T probably benign Het
Zfhx4 G C 3: 5,402,659 A2626P probably damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zwilch T A 9: 64,172,908 probably null Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACTGTGAATAGAGAGAACC -3'
(R):5'- CCTGTACCGTGTAGAAGGCTTC -3'

Sequencing Primer
(F):5'- TGTTCTCAGGAGACTCCGACAG -3'
(R):5'- TTCAGCCCAGTCAGTGTGAAG -3'
Posted On2017-02-10