Incidental Mutation 'R5865:Il4ra'
ID 454123
Institutional Source Beutler Lab
Gene Symbol Il4ra
Ensembl Gene ENSMUSG00000030748
Gene Name interleukin 4 receptor, alpha
Synonyms Il4r, IL-4 receptor alpha chain, CD124
MMRRC Submission 044074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5865 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 125552120-125579474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125575176 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 297 (S297P)
Ref Sequence ENSEMBL: ENSMUSP00000033004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033004] [ENSMUST00000206846]
AlphaFold P16382
Predicted Effect probably benign
Transcript: ENSMUST00000033004
AA Change: S297P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000033004
Gene: ENSMUSG00000030748
AA Change: S297P

DomainStartEndE-ValueType
Pfam:IL4Ra_N 28 122 9.9e-39 PFAM
FN3 124 211 3.14e0 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206681
Predicted Effect probably benign
Transcript: ENSMUST00000206846
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.7%
  • 20x: 88.7%
Validation Efficiency 91% (59/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Nullizygous mice exhibit reduced T helper 2 cell response to N. brasiliensis infection. Homozygotes for a null allele also display severe susceptibility to S. mansoni infection, enhanced carcinogen-induced intestinal tumour initiation, and altered control of chronic Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,712,128 V48M possibly damaging Het
Adamts2 T G 11: 50,803,954 Y1189* probably null Het
Bpifb9a T C 2: 154,266,836 I419T probably benign Het
Ccbe1 A T 18: 66,083,151 I167N possibly damaging Het
Ccdc187 T C 2: 26,293,368 T207A probably benign Het
Cd300lf G A 11: 115,126,300 L66F probably damaging Het
Cenpk A G 13: 104,236,194 *92W probably null Het
Col12a1 A T 9: 79,604,478 S2950R probably benign Het
Dnah3 T C 7: 119,975,108 T2154A probably benign Het
Ebna1bp2 A T 4: 118,621,135 probably benign Het
Elac2 G T 11: 64,997,957 C532F probably benign Het
Fam171a1 T A 2: 3,225,337 D377E probably benign Het
Haus6 A G 4: 86,586,357 C466R possibly damaging Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kank4 T C 4: 98,771,393 Y816C possibly damaging Het
Kcnc4 A T 3: 107,458,199 probably null Het
Kif21b C T 1: 136,151,137 R408* probably null Het
Lrrc31 A G 3: 30,679,140 V475A probably benign Het
Map2k1 C T 9: 64,191,266 probably null Het
Mc3r T A 2: 172,249,672 N271K possibly damaging Het
Ms4a14 A G 19: 11,304,217 S326P possibly damaging Het
Muc6 T A 7: 141,650,504 I358F probably damaging Het
Myo5c A G 9: 75,297,488 D1541G probably damaging Het
Myof T C 19: 37,910,934 S1793G probably damaging Het
Nfkb1 T A 3: 135,603,780 T518S probably damaging Het
Nphs1 T A 7: 30,474,385 I989N probably damaging Het
Olfr1024 T C 2: 85,904,521 T178A probably benign Het
Pcdha5 T C 18: 36,961,421 F328L probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Peg10 A G 6: 4,754,375 N52S probably damaging Het
Phf10 A C 17: 14,955,010 probably benign Het
Psme4 T C 11: 30,791,993 I152T possibly damaging Het
Ptpn18 T A 1: 34,471,563 probably benign Het
Rufy4 A T 1: 74,146,755 Y527F probably damaging Het
Snx32 T C 19: 5,496,354 M293V probably benign Het
Sorl1 A T 9: 41,983,034 L1827M possibly damaging Het
Sstr5 T A 17: 25,491,244 D337V probably benign Het
Tcaf3 A G 6: 42,596,697 F194L probably benign Het
Tcerg1 T A 18: 42,536,348 W459R probably damaging Het
Tet2 T A 3: 133,487,099 I525L probably benign Het
Tmem55b A G 14: 50,928,875 probably benign Het
Trim43b C T 9: 89,085,606 V325I probably benign Het
Txndc11 A T 16: 11,122,688 I180K probably damaging Het
Vmn1r193 A G 13: 22,219,225 L199P probably damaging Het
Vmn2r110 A G 17: 20,584,295 M121T probably benign Het
Zfhx4 G C 3: 5,402,659 A2626P probably damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zwilch T A 9: 64,172,908 probably null Het
Other mutations in Il4ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Il4ra APN 7 125569175 critical splice donor site probably null
IGL01067:Il4ra APN 7 125575161 missense probably benign 0.09
IGL01107:Il4ra APN 7 125575914 missense possibly damaging 0.88
IGL02224:Il4ra APN 7 125570099 splice site probably benign
IGL02249:Il4ra APN 7 125567224 missense probably benign 0.01
IGL02383:Il4ra APN 7 125571504 missense probably benign 0.06
IGL02614:Il4ra APN 7 125575790 nonsense probably null
IGL02879:Il4ra APN 7 125576897 missense possibly damaging 0.88
Haile UTSW 7 125574717 critical splice donor site probably null
Lowe UTSW 7 125567221 missense probably damaging 1.00
BB006:Il4ra UTSW 7 125575176 missense probably benign 0.00
BB016:Il4ra UTSW 7 125575176 missense probably benign 0.00
IGL02991:Il4ra UTSW 7 125575661 missense possibly damaging 0.70
PIT4418001:Il4ra UTSW 7 125576338 missense probably benign 0.01
R0066:Il4ra UTSW 7 125576231 missense possibly damaging 0.80
R0127:Il4ra UTSW 7 125569070 missense probably damaging 1.00
R0148:Il4ra UTSW 7 125575537 missense probably damaging 1.00
R0238:Il4ra UTSW 7 125575199 splice site probably benign
R0239:Il4ra UTSW 7 125575199 splice site probably benign
R0884:Il4ra UTSW 7 125574663 missense probably damaging 1.00
R1102:Il4ra UTSW 7 125574717 critical splice donor site probably null
R1622:Il4ra UTSW 7 125570053 missense possibly damaging 0.87
R1773:Il4ra UTSW 7 125567182 missense possibly damaging 0.94
R4510:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4511:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4612:Il4ra UTSW 7 125576083 missense probably benign 0.14
R5996:Il4ra UTSW 7 125567221 missense probably damaging 1.00
R6057:Il4ra UTSW 7 125571563 missense probably damaging 1.00
R6246:Il4ra UTSW 7 125576405 missense probably benign 0.00
R7218:Il4ra UTSW 7 125575778 missense probably benign 0.01
R7624:Il4ra UTSW 7 125569108 missense probably damaging 1.00
R7904:Il4ra UTSW 7 125565673 missense probably benign 0.05
R7929:Il4ra UTSW 7 125575176 missense probably benign 0.00
R8360:Il4ra UTSW 7 125569966 missense probably damaging 1.00
R9573:Il4ra UTSW 7 125569986 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGCCCTTTCACTGGTGTG -3'
(R):5'- ACTCAGCCACCCATGATTGC -3'

Sequencing Primer
(F):5'- GCAGAGGCTGAGACTCCCAG -3'
(R):5'- GAATTGATTGCCACCAGC -3'
Posted On 2017-02-10