Incidental Mutation 'R5865:Psme4'
ID 454132
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 044074-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5865 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30741993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 152 (I152T)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect possibly damaging
Transcript: ENSMUST00000041231
AA Change: I152T

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154757
AA Change: I160T
SMART Domains Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: I160T

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Meta Mutation Damage Score 0.4705 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.7%
  • 20x: 88.7%
Validation Efficiency 91% (59/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,766,277 (GRCm39) V48M possibly damaging Het
Adamts2 T G 11: 50,694,781 (GRCm39) Y1189* probably null Het
Bpifb9a T C 2: 154,108,756 (GRCm39) I419T probably benign Het
Ccbe1 A T 18: 66,216,222 (GRCm39) I167N possibly damaging Het
Ccdc187 T C 2: 26,183,380 (GRCm39) T207A probably benign Het
Cd300lf G A 11: 115,017,126 (GRCm39) L66F probably damaging Het
Cenpk A G 13: 104,372,702 (GRCm39) *92W probably null Het
Col12a1 A T 9: 79,511,760 (GRCm39) S2950R probably benign Het
Dnah3 T C 7: 119,574,331 (GRCm39) T2154A probably benign Het
Ebna1bp2 A T 4: 118,478,332 (GRCm39) probably benign Het
Elac2 G T 11: 64,888,783 (GRCm39) C532F probably benign Het
Fam171a1 T A 2: 3,226,374 (GRCm39) D377E probably benign Het
Haus6 A G 4: 86,504,594 (GRCm39) C466R possibly damaging Het
Il4ra T C 7: 125,174,348 (GRCm39) S297P probably benign Het
Itgb4 C T 11: 115,881,748 (GRCm39) R766W probably damaging Het
Kank4 T C 4: 98,659,630 (GRCm39) Y816C possibly damaging Het
Kcnc4 A T 3: 107,365,515 (GRCm39) probably null Het
Kif21b C T 1: 136,078,875 (GRCm39) R408* probably null Het
Lrrc31 A G 3: 30,733,289 (GRCm39) V475A probably benign Het
Map2k1 C T 9: 64,098,548 (GRCm39) probably null Het
Mc3r T A 2: 172,091,592 (GRCm39) N271K possibly damaging Het
Ms4a14 A G 19: 11,281,581 (GRCm39) S326P possibly damaging Het
Muc6 T A 7: 141,236,769 (GRCm39) I358F probably damaging Het
Myo5c A G 9: 75,204,770 (GRCm39) D1541G probably damaging Het
Myof T C 19: 37,899,382 (GRCm39) S1793G probably damaging Het
Nfkb1 T A 3: 135,309,541 (GRCm39) T518S probably damaging Het
Nphs1 T A 7: 30,173,810 (GRCm39) I989N probably damaging Het
Or5m12 T C 2: 85,734,865 (GRCm39) T178A probably benign Het
Pcdha5 T C 18: 37,094,474 (GRCm39) F328L probably benign Het
Pclo T A 5: 14,764,492 (GRCm39) S4322T probably benign Het
Peg10 A G 6: 4,754,375 (GRCm39) N52S probably damaging Het
Phf10 A C 17: 15,175,272 (GRCm39) probably benign Het
Pip4p1 A G 14: 51,166,332 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,510,644 (GRCm39) probably benign Het
Rufy4 A T 1: 74,185,914 (GRCm39) Y527F probably damaging Het
Snx32 T C 19: 5,546,382 (GRCm39) M293V probably benign Het
Sorl1 A T 9: 41,894,330 (GRCm39) L1827M possibly damaging Het
Sstr5 T A 17: 25,710,218 (GRCm39) D337V probably benign Het
Tcaf3 A G 6: 42,573,631 (GRCm39) F194L probably benign Het
Tcerg1 T A 18: 42,669,413 (GRCm39) W459R probably damaging Het
Tet2 T A 3: 133,192,860 (GRCm39) I525L probably benign Het
Trim43b C T 9: 88,967,659 (GRCm39) V325I probably benign Het
Txndc11 A T 16: 10,940,552 (GRCm39) I180K probably damaging Het
Vmn1r193 A G 13: 22,403,395 (GRCm39) L199P probably damaging Het
Vmn2r110 A G 17: 20,804,557 (GRCm39) M121T probably benign Het
Zfhx4 G C 3: 5,467,719 (GRCm39) A2626P probably damaging Het
Zfp445 C T 9: 122,682,552 (GRCm39) S463N probably benign Het
Zwilch T A 9: 64,080,190 (GRCm39) probably null Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCACACTGTGATTACCTG -3'
(R):5'- TAAGGATGACTGTTGAGATGTCTC -3'

Sequencing Primer
(F):5'- ACACTGTGATTACCTGTCCTC -3'
(R):5'- CAACCTGGTCTACATACATGGTGG -3'
Posted On 2017-02-10