Incidental Mutation 'R5866:Stat1'
ID454153
Institutional Source Beutler Lab
Gene Symbol Stat1
Ensembl Gene ENSMUSG00000026104
Gene Namesignal transducer and activator of transcription 1
Synonyms2010005J02Rik
MMRRC Submission 044075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52119440-52161865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52139264 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 286 (K286E)
Ref Sequence ENSEMBL: ENSMUSP00000139746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000186057] [ENSMUST00000186574] [ENSMUST00000186857] [ENSMUST00000189347] [ENSMUST00000191435]
Predicted Effect probably damaging
Transcript: ENSMUST00000070968
AA Change: K286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104
AA Change: K286E

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185743
Predicted Effect probably damaging
Transcript: ENSMUST00000186057
AA Change: K286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104
AA Change: K286E

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 3.4e-65 PFAM
Pfam:STAT_bind 317 573 3.9e-118 PFAM
SH2 577 693 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 721 745 2.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186574
AA Change: K286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104
AA Change: K286E

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186857
AA Change: K286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104
AA Change: K286E

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189347
AA Change: K286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104
AA Change: K286E

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191435
AA Change: K286E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104
AA Change: K286E

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Meta Mutation Damage Score 0.4118 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Stat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 start codon destroyed probably null 0.50
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.87
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 1.00
IGL01913:Stat1 APN 1 52126557 missense probably benign 0.08
IGL01914:Stat1 APN 1 52126557 missense probably benign 0.08
IGL02304:Stat1 APN 1 52132544 missense probably benign
IGL02428:Stat1 APN 1 52142966 splice site probably benign
domino UTSW 1 52140588 missense probably damaging 1.00
poison UTSW 1 52151225 splice site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense probably null
special UTSW 1 52139264 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.99
R0458:Stat1 UTSW 1 52149052 splice site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 missense probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R7105:Stat1 UTSW 1 52151249 missense probably benign 0.01
R7192:Stat1 UTSW 1 52135621 missense possibly damaging 0.65
R7284:Stat1 UTSW 1 52148922 missense probably benign 0.01
R7309:Stat1 UTSW 1 52126621 splice site probably null
R7491:Stat1 UTSW 1 52152371 missense probably benign 0.31
R7680:Stat1 UTSW 1 52144209 missense probably damaging 1.00
R7825:Stat1 UTSW 1 52151308 missense probably damaging 0.98
RF036:Stat1 UTSW 1 52152260 missense probably benign
RF060:Stat1 UTSW 1 52152260 missense probably benign
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATGTGATGCCCATAGC -3'
(R):5'- TGAAAACCGATTAGCCCGTC -3'

Sequencing Primer
(F):5'- GCCCATAGCATGTGGAGATTC -3'
(R):5'- ATCCAAAGAGTTCCTGGGC -3'
Posted On2017-02-10