Incidental Mutation 'R5866:Amy1'
ID454163
Institutional Source Beutler Lab
Gene Symbol Amy1
Ensembl Gene ENSMUSG00000074264
Gene Nameamylase 1, salivary
SynonymsAmy-1
MMRRC Submission 044075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location113555710-113606699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113561920 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 302 (M302K)
Ref Sequence ENSEMBL: ENSMUSP00000102150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067980] [ENSMUST00000106540] [ENSMUST00000142505] [ENSMUST00000174147]
AlphaFold P00687
Predicted Effect possibly damaging
Transcript: ENSMUST00000067980
AA Change: M302K

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070368
Gene: ENSMUSG00000074264
AA Change: M302K

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106540
AA Change: M302K

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102150
Gene: ENSMUSG00000074264
AA Change: M302K

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142505
SMART Domains Protein: ENSMUSP00000120493
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 36 271 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172885
Predicted Effect probably benign
Transcript: ENSMUST00000174147
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Meta Mutation Damage Score 0.3249 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Amy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Amy1 APN 3 113556132 missense probably damaging 1.00
IGL00966:Amy1 APN 3 113556040 missense probably benign 0.00
IGL01153:Amy1 APN 3 113556075 missense possibly damaging 0.69
IGL02415:Amy1 APN 3 113563585 missense probably benign 0.27
IGL02555:Amy1 APN 3 113564892 missense probably benign 0.01
IGL02572:Amy1 APN 3 113565073 splice site probably benign
IGL03215:Amy1 APN 3 113556000 missense probably benign
R0196:Amy1 UTSW 3 113569421 missense probably benign
R0230:Amy1 UTSW 3 113558430 missense probably benign 0.02
R0586:Amy1 UTSW 3 113562769 unclassified probably benign
R1789:Amy1 UTSW 3 113558165 missense possibly damaging 0.56
R1823:Amy1 UTSW 3 113562727 missense probably null
R1922:Amy1 UTSW 3 113564895 missense probably damaging 0.97
R2080:Amy1 UTSW 3 113558094 missense probably benign 0.01
R3147:Amy1 UTSW 3 113570048 start gained probably benign
R3437:Amy1 UTSW 3 113556009 missense probably damaging 1.00
R4961:Amy1 UTSW 3 113561849 missense probably damaging 1.00
R4977:Amy1 UTSW 3 113569377 splice site probably null
R5304:Amy1 UTSW 3 113558364 missense probably damaging 1.00
R5500:Amy1 UTSW 3 113562722 missense probably damaging 1.00
R5503:Amy1 UTSW 3 113556060 missense probably benign 0.26
R5706:Amy1 UTSW 3 113556120 missense probably damaging 0.99
R5956:Amy1 UTSW 3 113563662 missense probably benign 0.04
R6110:Amy1 UTSW 3 113561900 missense probably damaging 1.00
R6259:Amy1 UTSW 3 113569410 missense possibly damaging 0.73
R6278:Amy1 UTSW 3 113561690 missense probably damaging 1.00
R6429:Amy1 UTSW 3 113569509 missense probably damaging 1.00
R6893:Amy1 UTSW 3 113563632 missense probably benign 0.00
R7136:Amy1 UTSW 3 113563599 missense probably damaging 1.00
R7463:Amy1 UTSW 3 113569884 nonsense probably null
Z1177:Amy1 UTSW 3 113558353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACAGCCATTTTATAGAGTC -3'
(R):5'- CCTGAGATCATCTACATTGCAATC -3'

Sequencing Primer
(F):5'- CCTACCTAGCATCCCAGAAT -3'
(R):5'- TGCAATCTTACATGAAATGTGGATG -3'
Posted On2017-02-10