Incidental Mutation 'R5866:Aasdh'
ID 454168
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 044075-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R5866 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 77024058 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 198 (A198E)
Ref Sequence ENSEMBL: ENSMUSP00000117489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120639] [ENSMUST00000120963] [ENSMUST00000121160] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000149602] [ENSMUST00000163347]
AlphaFold Q80WC9
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: A1039E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: A1039E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: A1039E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: A1039E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121160
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145022
Predicted Effect probably damaging
Transcript: ENSMUST00000149602
AA Change: A198E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923
AA Change: A198E

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Meta Mutation Damage Score 0.2941 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,096,814 (GRCm39) probably benign Het
A530084C06Rik G A 13: 31,743,178 (GRCm39) A25V unknown Het
A730018C14Rik T C 12: 112,381,472 (GRCm39) noncoding transcript Het
Abcb8 C T 5: 24,607,101 (GRCm39) A328V probably damaging Het
Ace3 C A 11: 105,888,330 (GRCm39) H347N probably damaging Het
Amy1 A T 3: 113,355,569 (GRCm39) M302K possibly damaging Het
Apol11b C T 15: 77,524,747 (GRCm39) V13M probably null Het
Arfgef2 T A 2: 166,678,177 (GRCm39) V131E possibly damaging Het
Arnt T A 3: 95,398,037 (GRCm39) probably benign Het
Atl1 T C 12: 69,972,785 (GRCm39) V35A probably damaging Het
BC061237 A T 14: 44,738,730 (GRCm39) D43V possibly damaging Het
Cracd A G 5: 77,005,384 (GRCm39) T582A unknown Het
Cyp4f17 T C 17: 32,725,887 (GRCm39) S7P probably benign Het
Ddx60 A G 8: 62,393,774 (GRCm39) Y70C probably damaging Het
Defb34 T C 8: 19,176,468 (GRCm39) L53P probably damaging Het
Dennd5a T C 7: 109,518,567 (GRCm39) T525A probably benign Het
Ephb3 T C 16: 21,030,129 (GRCm39) probably benign Het
Fam83d T A 2: 158,621,750 (GRCm39) probably null Het
Gramd2b A G 18: 56,607,108 (GRCm39) D74G possibly damaging Het
Hax1 A G 3: 89,903,035 (GRCm39) probably benign Het
Kcnh8 T C 17: 53,263,804 (GRCm39) I767T probably benign Het
Ldah G A 12: 8,270,614 (GRCm39) V5I possibly damaging Het
Nbeal2 A G 9: 110,460,560 (GRCm39) V1758A probably damaging Het
Nos1 A G 5: 118,033,967 (GRCm39) D363G probably damaging Het
Or14j6 C T 17: 38,214,700 (GRCm39) R88* probably null Het
Pdlim7 T A 13: 55,646,501 (GRCm39) D445V probably damaging Het
Phip T A 9: 82,772,203 (GRCm39) M1115L probably benign Het
Pigb C T 9: 72,936,966 (GRCm39) A215T probably damaging Het
Pkd1 A T 17: 24,799,935 (GRCm39) S2952C probably damaging Het
Plxnb2 T C 15: 89,051,775 (GRCm39) D148G probably damaging Het
Ppp1r36 T C 12: 76,473,579 (GRCm39) F70S possibly damaging Het
Rad52 G A 6: 119,889,907 (GRCm39) probably benign Het
Rasa2 T A 9: 96,427,823 (GRCm39) T681S probably benign Het
Rel A T 11: 23,692,724 (GRCm39) Y436* probably null Het
Sec16a G A 2: 26,309,650 (GRCm39) P2119S probably benign Het
Sema6d C A 2: 124,506,262 (GRCm39) T733K probably benign Het
Sf3b3 C T 8: 111,541,266 (GRCm39) A950T probably benign Het
Slc24a5 T A 2: 124,927,591 (GRCm39) F297I probably damaging Het
Spp2 A T 1: 88,340,025 (GRCm39) D122V possibly damaging Het
Stap1 A G 5: 86,225,906 (GRCm39) K60R probably benign Het
Stat1 A G 1: 52,178,423 (GRCm39) K286E probably damaging Het
Stn1 T C 19: 47,505,568 (GRCm39) T129A probably benign Het
Tagap C T 17: 8,152,285 (GRCm39) T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 (GRCm39) E177G possibly damaging Het
Tln2 A T 9: 67,174,150 (GRCm39) L841Q probably damaging Het
Tmem59 T A 4: 107,047,754 (GRCm39) M71K probably damaging Het
Ugt2a3 G A 5: 87,484,406 (GRCm39) T206I probably damaging Het
Utp20 G A 10: 88,608,421 (GRCm39) H1539Y possibly damaging Het
Vps13a T C 19: 16,657,387 (GRCm39) N1794S probably benign Het
Vsig10 A T 5: 117,490,814 (GRCm39) probably null Het
Zfp97 T A 17: 17,365,087 (GRCm39) F195L possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0226:Aasdh UTSW 5 77,049,849 (GRCm39) missense probably damaging 1.00
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0386:Aasdh UTSW 5 77,044,308 (GRCm39) missense probably damaging 0.98
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1641:Aasdh UTSW 5 77,039,626 (GRCm39) missense probably benign 0.36
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1895:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3746:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3836:Aasdh UTSW 5 77,026,315 (GRCm39) missense probably benign 0.32
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 77,023,977 (GRCm39) missense probably damaging 1.00
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCACTGACATACTTACAAGGAC -3'
(R):5'- AGGGCCAATCTTCTCATCCC -3'

Sequencing Primer
(F):5'- ATACTTACAAGGACTACACCTGG -3'
(R):5'- ATCCCCATGCGTCTCGG -3'
Posted On 2017-02-10