Incidental Mutation 'R5866:Aasdh'
ID454168
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission 044075-MU
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76876211 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 198 (A198E)
Ref Sequence ENSEMBL: ENSMUSP00000117489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120639] [ENSMUST00000120963] [ENSMUST00000121160] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000149602] [ENSMUST00000163347]
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: A1039E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: A1039E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: A1039E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: A1039E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121160
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145022
Predicted Effect probably damaging
Transcript: ENSMUST00000149602
AA Change: A198E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923
AA Change: A198E

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Meta Mutation Damage Score 0.2941 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 unclassified probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCACTGACATACTTACAAGGAC -3'
(R):5'- AGGGCCAATCTTCTCATCCC -3'

Sequencing Primer
(F):5'- ATACTTACAAGGACTACACCTGG -3'
(R):5'- ATCCCCATGCGTCTCGG -3'
Posted On2017-02-10