Incidental Mutation 'R5866:Atl1'
ID454187
Institutional Source Beutler Lab
Gene Symbol Atl1
Ensembl Gene ENSMUSG00000021066
Gene Nameatlastin GTPase 1
SynonymsAD-FSP, Spg3a, FSP1, SPG3
MMRRC Submission 044075-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R5866 (G1)
Quality Score143
Status Validated
Chromosome12
Chromosomal Location69892614-69966417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69926011 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 35 (V35A)
Ref Sequence ENSEMBL: ENSMUSP00000152131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021466] [ENSMUST00000223456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021466
AA Change: V35A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: V35A

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:GBP 43 314 2.3e-103 PFAM
low complexity region 350 363 N/A INTRINSIC
Blast:HAMP 468 519 9e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082064
SMART Domains Protein: ENSMUSP00000100794
Gene: ENSMUSG00000078370

DomainStartEndE-ValueType
Gp_dh_N 2 156 1.4e-103 SMART
Pfam:Gp_dh_C 161 318 5e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222141
Predicted Effect probably damaging
Transcript: ENSMUST00000223456
AA Change: V35A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.1483 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Atl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Atl1 APN 12 69932238 missense probably damaging 0.99
IGL02035:Atl1 APN 12 69960544 unclassified probably benign
IGL02229:Atl1 APN 12 69926025 missense probably benign 0.01
IGL03282:Atl1 APN 12 69954464 missense possibly damaging 0.87
IGL03374:Atl1 APN 12 69955367 missense probably damaging 1.00
R1538:Atl1 UTSW 12 69926188 missense probably benign 0.02
R1819:Atl1 UTSW 12 69963300 missense probably benign
R1903:Atl1 UTSW 12 69959275 missense probably damaging 0.98
R1961:Atl1 UTSW 12 69953500 missense probably benign 0.00
R1990:Atl1 UTSW 12 69963328 missense probably damaging 1.00
R2126:Atl1 UTSW 12 69931657 splice site probably null
R3724:Atl1 UTSW 12 69959380 missense probably damaging 0.99
R4402:Atl1 UTSW 12 69959199 missense probably benign 0.09
R5241:Atl1 UTSW 12 69959113 missense possibly damaging 0.52
R5256:Atl1 UTSW 12 69959333 missense probably damaging 1.00
R5285:Atl1 UTSW 12 69954499 missense probably benign 0.18
R6001:Atl1 UTSW 12 69932283 missense possibly damaging 0.92
R6434:Atl1 UTSW 12 69959425 nonsense probably null
R6677:Atl1 UTSW 12 69953444 missense probably damaging 0.99
R6728:Atl1 UTSW 12 69947550 missense possibly damaging 0.95
R6974:Atl1 UTSW 12 69926039 missense probably damaging 0.99
R7013:Atl1 UTSW 12 69953440 missense probably damaging 1.00
R7121:Atl1 UTSW 12 69931634 missense probably damaging 0.99
R7224:Atl1 UTSW 12 69955353 missense probably benign
R7437:Atl1 UTSW 12 69931622 missense probably benign 0.37
R8043:Atl1 UTSW 12 69959215 missense probably damaging 1.00
R8319:Atl1 UTSW 12 69955319 missense probably damaging 0.99
Z1176:Atl1 UTSW 12 69937075 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGACCAGGAAGACAAGTCCC -3'
(R):5'- ATGTACCGCAACATGAAGTCC -3'

Sequencing Primer
(F):5'- AAGACAAGTCCCGGTCTGGTC -3'
(R):5'- CGCAACATGAAGTCCATCAGG -3'
Posted On2017-02-10