Incidental Mutation 'R5866:Ppp1r36'
ID454188
Institutional Source Beutler Lab
Gene Symbol Ppp1r36
Ensembl Gene ENSMUSG00000052221
Gene Nameprotein phosphatase 1, regulatory subunit 36
Synonyms
MMRRC Submission 044075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76417538-76439492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76426805 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 70 (F70S)
Ref Sequence ENSEMBL: ENSMUSP00000069849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063977] [ENSMUST00000220187]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063977
AA Change: F70S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069849
Gene: ENSMUSG00000052221
AA Change: F70S

DomainStartEndE-ValueType
Pfam:PPPI_inhib 52 402 5.7e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218732
Predicted Effect probably benign
Transcript: ENSMUST00000220187
Meta Mutation Damage Score 0.1457 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Ppp1r36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Ppp1r36 APN 12 76439117 critical splice acceptor site probably null
IGL01744:Ppp1r36 APN 12 76439232 missense possibly damaging 0.83
IGL03295:Ppp1r36 APN 12 76438418 missense probably damaging 0.97
R0099:Ppp1r36 UTSW 12 76436282 splice site probably null
R0332:Ppp1r36 UTSW 12 76427903 missense probably benign 0.32
R0463:Ppp1r36 UTSW 12 76418967 missense probably damaging 0.98
R0491:Ppp1r36 UTSW 12 76439291 missense probably benign 0.01
R1664:Ppp1r36 UTSW 12 76436254 missense possibly damaging 0.84
R2011:Ppp1r36 UTSW 12 76418926 critical splice acceptor site probably null
R3918:Ppp1r36 UTSW 12 76417657 missense probably benign 0.00
R5352:Ppp1r36 UTSW 12 76428083 missense probably damaging 1.00
R5464:Ppp1r36 UTSW 12 76428078 critical splice acceptor site probably null
R5490:Ppp1r36 UTSW 12 76437986 missense probably damaging 0.98
R5490:Ppp1r36 UTSW 12 76437987 missense possibly damaging 0.85
R5523:Ppp1r36 UTSW 12 76438118 missense possibly damaging 0.71
R5844:Ppp1r36 UTSW 12 76426792 missense possibly damaging 0.71
R5849:Ppp1r36 UTSW 12 76439157 missense probably damaging 0.99
R5996:Ppp1r36 UTSW 12 76439162 missense possibly damaging 0.71
R6443:Ppp1r36 UTSW 12 76417639 missense probably benign
R6612:Ppp1r36 UTSW 12 76437604 missense possibly damaging 0.52
R6756:Ppp1r36 UTSW 12 76427922 missense probably benign 0.28
R7979:Ppp1r36 UTSW 12 76428149 splice site probably null
X0025:Ppp1r36 UTSW 12 76426810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGAAGGTGTGAATCTTCCTC -3'
(R):5'- TATCAAAGGAATGACCGTCTAGGATC -3'

Sequencing Primer
(F):5'- GTGGCTCCACGTGTAAAATAC -3'
(R):5'- CTAGGATCTGTTTGTAATTCCAGC -3'
Posted On2017-02-10