Incidental Mutation 'R5866:Vps13a'
ID454203
Institutional Source Beutler Lab
Gene Symbol Vps13a
Ensembl Gene ENSMUSG00000046230
Gene Namevacuolar protein sorting 13A
Synonyms4930516E05Rik, 4930543C13Rik, D330038K10Rik
MMRRC Submission 044075-MU
Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16615366-16780933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16680023 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1794 (N1794S)
Ref Sequence ENSEMBL: ENSMUSP00000153129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]
Predicted Effect probably benign
Transcript: ENSMUST00000068156
AA Change: N1794S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: N1794S

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 5.4e-38 PFAM
Pfam:VPS13 139 371 3.7e-64 PFAM
low complexity region 553 563 N/A INTRINSIC
Pfam:VPS13_mid_rpt 567 791 1.4e-69 PFAM
Pfam:VPS13_mid_rpt 1138 1329 2e-10 PFAM
low complexity region 1367 1377 N/A INTRINSIC
Blast:INB 1575 1855 1e-149 BLAST
Pfam:SHR-BD 2200 2449 1.3e-35 PFAM
low complexity region 2510 2521 N/A INTRINSIC
low complexity region 2632 2648 N/A INTRINSIC
low complexity region 2719 2731 N/A INTRINSIC
Pfam:VPS13_C 2755 2935 8.9e-66 PFAM
Pfam:ATG_C 2938 3029 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223897
Predicted Effect probably benign
Transcript: ENSMUST00000224149
AA Change: N1794S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Vps13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Vps13a APN 19 16752175 missense probably damaging 0.98
IGL00537:Vps13a APN 19 16680045 missense probably benign 0.03
IGL00562:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00563:Vps13a APN 19 16734714 critical splice donor site probably null
IGL00579:Vps13a APN 19 16707362 missense probably benign 0.29
IGL00662:Vps13a APN 19 16704540 missense probably damaging 0.96
IGL00667:Vps13a APN 19 16759676 missense probably damaging 1.00
IGL01102:Vps13a APN 19 16651417 critical splice donor site probably null
IGL01139:Vps13a APN 19 16640625 missense probably damaging 0.99
IGL01142:Vps13a APN 19 16687115 missense possibly damaging 0.86
IGL01361:Vps13a APN 19 16743007 missense probably damaging 1.00
IGL01386:Vps13a APN 19 16701152 missense possibly damaging 0.87
IGL01593:Vps13a APN 19 16762181 missense probably damaging 0.98
IGL01700:Vps13a APN 19 16744857 nonsense probably null
IGL01767:Vps13a APN 19 16663894 missense probably damaging 1.00
IGL01782:Vps13a APN 19 16754337 missense probably damaging 0.98
IGL01808:Vps13a APN 19 16710286 missense probably damaging 1.00
IGL01812:Vps13a APN 19 16715060 missense probably benign
IGL01829:Vps13a APN 19 16619443 missense probably benign 0.01
IGL01893:Vps13a APN 19 16663775 missense probably damaging 1.00
IGL02222:Vps13a APN 19 16682175 missense probably benign 0.06
IGL02295:Vps13a APN 19 16715042 splice site probably benign
IGL02465:Vps13a APN 19 16710941 missense probably benign 0.11
IGL02492:Vps13a APN 19 16647637 missense probably damaging 1.00
IGL02581:Vps13a APN 19 16655322 missense probably benign 0.41
IGL02633:Vps13a APN 19 16720408 missense possibly damaging 0.82
IGL02641:Vps13a APN 19 16698821 missense probably benign 0.01
IGL02659:Vps13a APN 19 16652699 missense probably damaging 1.00
IGL02827:Vps13a APN 19 16641634 missense possibly damaging 0.91
IGL02943:Vps13a APN 19 16663886 missense probably damaging 1.00
IGL03057:Vps13a APN 19 16668694 missense probably damaging 1.00
IGL03077:Vps13a APN 19 16710882 missense probably benign
IGL03184:Vps13a APN 19 16654370 missense probably benign 0.00
eggs UTSW 19 16701165 missense probably damaging 1.00
excambio UTSW 19 16745947 splice site probably null
Ham UTSW 19 16677969 missense probably benign 0.08
interchange UTSW 19 16668690 missense probably damaging 1.00
PIT4377001:Vps13a UTSW 19 16740901 missense probably damaging 1.00
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0045:Vps13a UTSW 19 16640810 nonsense probably null
R0048:Vps13a UTSW 19 16676140 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0062:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R0107:Vps13a UTSW 19 16691824 missense probably benign 0.03
R0135:Vps13a UTSW 19 16780765 missense probably damaging 1.00
R0138:Vps13a UTSW 19 16660499 missense possibly damaging 0.95
R0346:Vps13a UTSW 19 16677969 missense probably benign 0.08
R0359:Vps13a UTSW 19 16641577 missense probably damaging 0.99
R0530:Vps13a UTSW 19 16655206 splice site probably benign
R0541:Vps13a UTSW 19 16704577 missense probably benign 0.00
R0614:Vps13a UTSW 19 16652694 missense probably damaging 1.00
R0685:Vps13a UTSW 19 16780741 missense probably damaging 1.00
R0801:Vps13a UTSW 19 16686656 splice site probably benign
R0835:Vps13a UTSW 19 16734882 intron probably null
R0848:Vps13a UTSW 19 16698897 missense probably damaging 1.00
R1114:Vps13a UTSW 19 16750151 missense probably benign 0.41
R1205:Vps13a UTSW 19 16640541 missense probably damaging 1.00
R1365:Vps13a UTSW 19 16619446 missense probably damaging 1.00
R1445:Vps13a UTSW 19 16701238 nonsense probably null
R1451:Vps13a UTSW 19 16710864 missense probably benign 0.01
R1479:Vps13a UTSW 19 16750114 splice site probably benign
R1533:Vps13a UTSW 19 16701130 nonsense probably null
R1600:Vps13a UTSW 19 16666272 missense probably benign 0.01
R1870:Vps13a UTSW 19 16759952 missense probably damaging 1.00
R1871:Vps13a UTSW 19 16664664 missense probably benign 0.01
R1959:Vps13a UTSW 19 16677938 missense possibly damaging 0.49
R1960:Vps13a UTSW 19 16725631 missense probably damaging 1.00
R1993:Vps13a UTSW 19 16722458 missense probably benign 0.07
R2257:Vps13a UTSW 19 16682174 missense possibly damaging 0.85
R2276:Vps13a UTSW 19 16710426 missense possibly damaging 0.47
R2326:Vps13a UTSW 19 16743057 missense possibly damaging 0.71
R2338:Vps13a UTSW 19 16720453 missense probably damaging 1.00
R2359:Vps13a UTSW 19 16652679 splice site probably benign
R2421:Vps13a UTSW 19 16759671 missense probably benign
R2847:Vps13a UTSW 19 16703599 missense probably damaging 0.98
R3081:Vps13a UTSW 19 16664737 missense probably benign 0.02
R3522:Vps13a UTSW 19 16766493 splice site probably benign
R3613:Vps13a UTSW 19 16685402 missense probably damaging 1.00
R3797:Vps13a UTSW 19 16745947 splice site probably null
R3874:Vps13a UTSW 19 16744953 missense probably benign 0.01
R4032:Vps13a UTSW 19 16616899 missense probably damaging 1.00
R4111:Vps13a UTSW 19 16640628 missense probably damaging 1.00
R4383:Vps13a UTSW 19 16701165 missense probably damaging 1.00
R4504:Vps13a UTSW 19 16695502 missense possibly damaging 0.93
R4578:Vps13a UTSW 19 16682110 missense probably damaging 0.98
R4587:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4588:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4605:Vps13a UTSW 19 16640039 missense probably damaging 1.00
R4714:Vps13a UTSW 19 16749856 missense probably benign 0.01
R4756:Vps13a UTSW 19 16655216 missense probably benign 0.01
R4831:Vps13a UTSW 19 16677992 missense probably benign 0.04
R5068:Vps13a UTSW 19 16746058 missense probably benign 0.01
R5070:Vps13a UTSW 19 16654484 missense probably benign
R5082:Vps13a UTSW 19 16744893 missense probably damaging 1.00
R5182:Vps13a UTSW 19 16695499 missense possibly damaging 0.81
R5189:Vps13a UTSW 19 16685315 missense probably damaging 1.00
R5283:Vps13a UTSW 19 16677970 missense probably damaging 0.96
R5294:Vps13a UTSW 19 16641667 missense probably damaging 1.00
R5304:Vps13a UTSW 19 16710387 missense possibly damaging 0.78
R5554:Vps13a UTSW 19 16722411 missense probably damaging 1.00
R5592:Vps13a UTSW 19 16725571 missense probably damaging 1.00
R5611:Vps13a UTSW 19 16725572 missense probably damaging 1.00
R5665:Vps13a UTSW 19 16668690 missense probably damaging 1.00
R5671:Vps13a UTSW 19 16715100 missense probably benign 0.03
R5684:Vps13a UTSW 19 16699045 missense probably benign 0.00
R5767:Vps13a UTSW 19 16664564 missense probably damaging 1.00
R5810:Vps13a UTSW 19 16666324 missense probably benign 0.00
R5886:Vps13a UTSW 19 16664562 missense probably benign 0.01
R5933:Vps13a UTSW 19 16660530 missense probably benign 0.34
R5965:Vps13a UTSW 19 16619028 intron probably null
R6259:Vps13a UTSW 19 16687170 nonsense probably null
R6346:Vps13a UTSW 19 16682214 missense possibly damaging 0.94
R6459:Vps13a UTSW 19 16664018 missense possibly damaging 0.56
R6485:Vps13a UTSW 19 16680050 missense probably damaging 0.99
R6520:Vps13a UTSW 19 16725579 missense probably damaging 1.00
R6644:Vps13a UTSW 19 16744919 missense possibly damaging 0.90
R6932:Vps13a UTSW 19 16678075 missense probably benign 0.01
R6934:Vps13a UTSW 19 16676194 missense probably damaging 1.00
R6951:Vps13a UTSW 19 16723740 missense probably benign 0.00
R7027:Vps13a UTSW 19 16664664 missense probably benign 0.01
R7126:Vps13a UTSW 19 16710879 missense probably benign
R7206:Vps13a UTSW 19 16754298 missense probably damaging 1.00
R7248:Vps13a UTSW 19 16678042 missense probably benign 0.25
R7252:Vps13a UTSW 19 16661064 missense probably benign 0.00
R7255:Vps13a UTSW 19 16654339 critical splice donor site probably null
R7382:Vps13a UTSW 19 16619485 missense probably damaging 1.00
R7422:Vps13a UTSW 19 16750173 missense probably damaging 1.00
R7425:Vps13a UTSW 19 16723702 missense probably benign 0.13
R7523:Vps13a UTSW 19 16703789 missense probably benign
R7586:Vps13a UTSW 19 16647598 missense probably benign 0.08
R7587:Vps13a UTSW 19 16703789 missense probably benign 0.00
R7593:Vps13a UTSW 19 16725663 missense probably damaging 1.00
R7637:Vps13a UTSW 19 16750149 missense probably benign 0.02
R7763:Vps13a UTSW 19 16746000 missense possibly damaging 0.95
R7813:Vps13a UTSW 19 16651456 missense possibly damaging 0.81
R7815:Vps13a UTSW 19 16725572 missense probably damaging 1.00
X0061:Vps13a UTSW 19 16645868 missense probably benign 0.40
X0066:Vps13a UTSW 19 16742553 missense probably benign 0.33
Z31818:Vps13a UTSW 19 16780754 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATAGATATCCTCTCAAAAGCTCTGG -3'
(R):5'- TGTGAAGAAGAAATAGCATACTCGC -3'

Sequencing Primer
(F):5'- TATCCTCTCAAAAGCTCTGGAAAGC -3'
(R):5'- CATACTCGCAAGGTAGGGTG -3'
Posted On2017-02-10