Incidental Mutation 'R5866:Stn1'
ID454204
Institutional Source Beutler Lab
Gene Symbol Stn1
Ensembl Gene ENSMUSG00000042694
Gene NameSTN1, CST complex subunit
Synonyms0610009H20Rik, 2310057J23Rik, Obfc1
MMRRC Submission 044075-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47501033-47537507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47517129 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 129 (T129A)
Ref Sequence ENSEMBL: ENSMUSP00000040944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049369] [ENSMUST00000182808]
PDB Structure
Solution structure of the hypothetical domain of RIKEN cDNA 0610009H20 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000049369
AA Change: T129A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040944
Gene: ENSMUSG00000042694
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Stn1 31 110 1.4e-8 PFAM
Pfam:tRNA_anti-codon 64 165 3e-8 PFAM
Pfam:STN1_2 167 344 7.9e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182109
Predicted Effect probably benign
Transcript: ENSMUST00000182808
AA Change: T129A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138727
Gene: ENSMUSG00000042694
AA Change: T129A

DomainStartEndE-ValueType
Pfam:Stn1 31 110 1.8e-5 PFAM
Pfam:tRNA_anti-codon 64 165 4.1e-7 PFAM
Pfam:STN1_2 167 330 2.7e-70 PFAM
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] OBFC1 and C17ORF68 (MIM 613129) are subunits of an alpha accessory factor (AAF) that stimulates the activity of DNA polymerase-alpha-primase (see MIM 176636), the enzyme that initiates DNA replication (Casteel et al., 2009 [PubMed 19119139]). OBFC1 also appears to function in a telomere-associated complex with C17ORF68 and TEN1 (C17ORF106; MIM 613130) (Miyake et al., 2009 [PubMed 19854130]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Stn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Stn1 APN 19 47516173 missense possibly damaging 0.71
IGL02338:Stn1 APN 19 47513890 missense probably damaging 1.00
R0309:Stn1 UTSW 19 47501673 missense probably benign 0.01
R1552:Stn1 UTSW 19 47536373 critical splice acceptor site probably null
R3907:Stn1 UTSW 19 47507823 missense probably damaging 1.00
R6652:Stn1 UTSW 19 47507578 missense probably benign
R8328:Stn1 UTSW 19 47517059 missense probably damaging 1.00
R8519:Stn1 UTSW 19 47501672 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGGAGTCTGACTTCCAGC -3'
(R):5'- GATGCTTTGAAAAGGTACCAGG -3'

Sequencing Primer
(F):5'- TGGAGTCTGACTTCCAGCTAAAC -3'
(R):5'- AGGAGCTATTATACTAGAACGCC -3'
Posted On2017-02-10