Incidental Mutation 'R5867:Cdh7'
ID454206
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Namecadherin 7, type 2
SynonymsCDH7L1
MMRRC Submission 043233-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5867 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location109982431-110140157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110048851 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 82 (I82N)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
Predicted Effect probably damaging
Transcript: ENSMUST00000027542
AA Change: I82N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: I82N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112701
AA Change: I82N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: I82N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000172005
AA Change: I82N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: I82N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,052 V2900A probably damaging Het
Akip1 A G 7: 109,707,477 H127R probably benign Het
Alad A T 4: 62,512,966 Y56N probably damaging Het
Aldoart1 T A 4: 72,852,533 M13L probably benign Het
Ap1g1 C T 8: 109,818,982 A89V probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Cd209b T C 8: 3,924,246 I89V possibly damaging Het
Cd36 T C 5: 17,785,735 K469R probably benign Het
Clmn G T 12: 104,781,755 P511H probably damaging Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Cyp2a5 T C 7: 26,842,958 F462L probably benign Het
Dclk2 A G 3: 86,791,859 *709Q probably null Het
Drd1 T C 13: 54,054,163 T4A probably benign Het
Ephb2 C T 4: 136,675,422 V513I possibly damaging Het
Fam43a T A 16: 30,601,459 V287E probably benign Het
Gm5134 A G 10: 76,008,616 E602G probably benign Het
Gtsf2 C T 15: 103,439,636 G149E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhl6 T C 16: 19,982,820 T62A probably benign Het
Lamb1 T A 12: 31,298,955 I662N possibly damaging Het
Lmod3 A G 6: 97,248,002 V286A probably damaging Het
Mefv T C 16: 3,715,933 D158G probably damaging Het
Mff T C 1: 82,750,606 probably null Het
Mfsd6l G T 11: 68,557,210 V296L possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Olfr1033 A G 2: 86,041,451 I45M probably benign Het
Pdk4 T A 6: 5,487,452 H266L probably benign Het
Pdrg1 T C 2: 153,014,055 N40D probably damaging Het
Pi4k2a T C 19: 42,105,485 probably null Het
Pkd1l2 T A 8: 117,055,011 D765V probably damaging Het
Pspc1 A T 14: 56,762,041 probably null Het
Ptprm T C 17: 67,045,981 probably null Het
Spata31d1d T C 13: 59,727,240 K827R possibly damaging Het
Srebf2 T A 15: 82,169,786 F46Y probably damaging Het
Tfrc T A 16: 32,620,412 C365S possibly damaging Het
Ttc7 A G 17: 87,322,472 H294R possibly damaging Het
Ubr7 T A 12: 102,761,494 Y92N probably damaging Het
Vmn1r42 A C 6: 89,844,779 Y269* probably null Het
Vmn2r1 A G 3: 64,104,569 E617G probably benign Het
Vps13c A G 9: 67,982,622 probably null Het
Vps50 T C 6: 3,536,965 L312P probably damaging Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zcchc3 A G 2: 152,414,524 F85S probably damaging Het
Zfhx3 T C 8: 108,793,446 L400P probably damaging Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0549:Cdh7 UTSW 1 110108944 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1033:Cdh7 UTSW 1 110085053 missense probably damaging 0.96
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1769:Cdh7 UTSW 1 110052876 missense probably damaging 1.00
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1940:Cdh7 UTSW 1 110049024 missense probably benign 0.09
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2137:Cdh7 UTSW 1 110100106 missense probably damaging 0.97
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
R7511:Cdh7 UTSW 1 109997853 intron probably benign
R7532:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R7879:Cdh7 UTSW 1 110048947 missense probably benign 0.01
R8022:Cdh7 UTSW 1 110061108 missense probably benign 0.02
R8207:Cdh7 UTSW 1 109994346 missense probably damaging 1.00
R8224:Cdh7 UTSW 1 109994203 missense probably benign
R8239:Cdh7 UTSW 1 110100102 missense probably benign 0.11
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Z1176:Cdh7 UTSW 1 110108736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTTAGCACAATCAGCAC -3'
(R):5'- ATGGACCATCTAGAAATTTGGGTTC -3'

Sequencing Primer
(F):5'- GCTTCTTAGCACAATCAGCACTTAGC -3'
(R):5'- CTTGATAACAAACTCTGATTCAGGC -3'
Posted On2017-02-10