Incidental Mutation 'R5867:Ephb2'
ID454215
Institutional Source Beutler Lab
Gene Symbol Ephb2
Ensembl Gene ENSMUSG00000028664
Gene NameEph receptor B2
SynonymsErk, eteck, Tyro5, Prkm5, Drt, Hek5, Sek3, Qek5, Cek5, Nuk
MMRRC Submission 043233-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R5867 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136647539-136835988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136675422 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 513 (V513I)
Ref Sequence ENSEMBL: ENSMUSP00000101472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059287
AA Change: V514I

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: V514I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 261 304 8.1e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 518 1.23e-10 SMART
Pfam:EphA2_TM 545 619 6e-25 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105845
AA Change: V513I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: V513I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 618 2.1e-30 PFAM
TyrKc 621 880 1.34e-138 SMART
SAM 910 977 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105846
AA Change: V513I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: V513I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 619 1e-30 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000156558
AA Change: V181I
SMART Domains Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664
AA Change: V181I

DomainStartEndE-ValueType
FN3 1 85 6.48e1 SMART
FN3 104 186 1.23e-10 SMART
Pfam:EphA2_TM 213 276 2.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,052 V2900A probably damaging Het
Akip1 A G 7: 109,707,477 H127R probably benign Het
Alad A T 4: 62,512,966 Y56N probably damaging Het
Aldoart1 T A 4: 72,852,533 M13L probably benign Het
Ap1g1 C T 8: 109,818,982 A89V probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Cd209b T C 8: 3,924,246 I89V possibly damaging Het
Cd36 T C 5: 17,785,735 K469R probably benign Het
Cdh7 T A 1: 110,048,851 I82N probably damaging Het
Clmn G T 12: 104,781,755 P511H probably damaging Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Cyp2a5 T C 7: 26,842,958 F462L probably benign Het
Dclk2 A G 3: 86,791,859 *709Q probably null Het
Drd1 T C 13: 54,054,163 T4A probably benign Het
Fam43a T A 16: 30,601,459 V287E probably benign Het
Gm5134 A G 10: 76,008,616 E602G probably benign Het
Gtsf2 C T 15: 103,439,636 G149E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhl6 T C 16: 19,982,820 T62A probably benign Het
Lamb1 T A 12: 31,298,955 I662N possibly damaging Het
Lmod3 A G 6: 97,248,002 V286A probably damaging Het
Mefv T C 16: 3,715,933 D158G probably damaging Het
Mff T C 1: 82,750,606 probably null Het
Mfsd6l G T 11: 68,557,210 V296L possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Olfr1033 A G 2: 86,041,451 I45M probably benign Het
Pdk4 T A 6: 5,487,452 H266L probably benign Het
Pdrg1 T C 2: 153,014,055 N40D probably damaging Het
Pi4k2a T C 19: 42,105,485 probably null Het
Pkd1l2 T A 8: 117,055,011 D765V probably damaging Het
Pspc1 A T 14: 56,762,041 probably null Het
Ptprm T C 17: 67,045,981 probably null Het
Spata31d1d T C 13: 59,727,240 K827R possibly damaging Het
Srebf2 T A 15: 82,169,786 F46Y probably damaging Het
Tfrc T A 16: 32,620,412 C365S possibly damaging Het
Ttc7 A G 17: 87,322,472 H294R possibly damaging Het
Ubr7 T A 12: 102,761,494 Y92N probably damaging Het
Vmn1r42 A C 6: 89,844,779 Y269* probably null Het
Vmn2r1 A G 3: 64,104,569 E617G probably benign Het
Vps13c A G 9: 67,982,622 probably null Het
Vps50 T C 6: 3,536,965 L312P probably damaging Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zcchc3 A G 2: 152,414,524 F85S probably damaging Het
Zfhx3 T C 8: 108,793,446 L400P probably damaging Het
Other mutations in Ephb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ephb2 APN 4 136657484 missense probably damaging 0.96
IGL00963:Ephb2 APN 4 136658951 missense probably benign 0.04
IGL01111:Ephb2 APN 4 136657410 missense probably benign 0.01
IGL01462:Ephb2 APN 4 136771370 missense possibly damaging 0.61
IGL01863:Ephb2 APN 4 136659777 missense probably benign 0.03
IGL02149:Ephb2 APN 4 136693914 missense probably damaging 1.00
IGL02232:Ephb2 APN 4 136657451 missense probably damaging 0.97
IGL02269:Ephb2 APN 4 136771049 missense possibly damaging 0.66
IGL02828:Ephb2 APN 4 136771150 missense probably benign 0.09
IGL03109:Ephb2 APN 4 136771544 missense probably damaging 1.00
IGL03284:Ephb2 APN 4 136661516 missense probably damaging 0.96
PIT4453001:Ephb2 UTSW 4 136660810 missense probably benign 0.00
R0004:Ephb2 UTSW 4 136657524 missense probably damaging 1.00
R0121:Ephb2 UTSW 4 136771057 missense probably damaging 0.99
R0539:Ephb2 UTSW 4 136655976 missense probably damaging 1.00
R0614:Ephb2 UTSW 4 136673365 missense probably benign 0.00
R0988:Ephb2 UTSW 4 136659708 missense possibly damaging 0.59
R1471:Ephb2 UTSW 4 136658951 missense probably benign 0.04
R1473:Ephb2 UTSW 4 136694058 missense possibly damaging 0.83
R1546:Ephb2 UTSW 4 136771009 missense probably damaging 0.99
R1639:Ephb2 UTSW 4 136693905 missense probably benign 0.10
R1725:Ephb2 UTSW 4 136659778 nonsense probably null
R1779:Ephb2 UTSW 4 136693825 missense possibly damaging 0.64
R1818:Ephb2 UTSW 4 136655336 missense probably benign 0.02
R2099:Ephb2 UTSW 4 136660755 missense probably damaging 1.00
R2916:Ephb2 UTSW 4 136683945 missense probably damaging 0.99
R3885:Ephb2 UTSW 4 136771034 missense probably damaging 1.00
R4572:Ephb2 UTSW 4 136655940 missense probably damaging 1.00
R4709:Ephb2 UTSW 4 136696052 missense probably damaging 1.00
R4893:Ephb2 UTSW 4 136659753 missense probably damaging 0.99
R4981:Ephb2 UTSW 4 136696010 missense probably benign 0.09
R4992:Ephb2 UTSW 4 136660839 missense probably damaging 1.00
R5004:Ephb2 UTSW 4 136659699 missense possibly damaging 0.77
R5307:Ephb2 UTSW 4 136693787 missense possibly damaging 0.89
R5370:Ephb2 UTSW 4 136771570 missense probably benign 0.00
R5561:Ephb2 UTSW 4 136661406 missense probably damaging 1.00
R5643:Ephb2 UTSW 4 136771612 missense probably damaging 0.99
R5826:Ephb2 UTSW 4 136660737 missense probably damaging 1.00
R5858:Ephb2 UTSW 4 136672445 missense probably benign
R5990:Ephb2 UTSW 4 136696055 missense probably benign 0.03
R6000:Ephb2 UTSW 4 136684030 missense possibly damaging 0.76
R6156:Ephb2 UTSW 4 136661505 missense probably benign 0.44
R6413:Ephb2 UTSW 4 136771122 missense probably benign 0.08
R6577:Ephb2 UTSW 4 136657550 missense probably damaging 0.99
R6633:Ephb2 UTSW 4 136683996 missense probably benign 0.07
R6720:Ephb2 UTSW 4 136657502 missense probably damaging 0.99
R6795:Ephb2 UTSW 4 136673335 missense possibly damaging 0.88
R7235:Ephb2 UTSW 4 136693828 missense probably damaging 1.00
R7260:Ephb2 UTSW 4 136771574 missense probably damaging 0.96
R7328:Ephb2 UTSW 4 136658934 critical splice donor site probably null
R7404:Ephb2 UTSW 4 136771213 missense probably damaging 1.00
R7466:Ephb2 UTSW 4 136659065 missense probably damaging 1.00
R7524:Ephb2 UTSW 4 136659709 missense probably damaging 1.00
R7605:Ephb2 UTSW 4 136771108 missense probably damaging 1.00
R7611:Ephb2 UTSW 4 136660901 critical splice acceptor site probably null
R7777:Ephb2 UTSW 4 136771636 missense possibly damaging 0.92
R7889:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
R7972:Ephb2 UTSW 4 136771042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCGCAGTTTGTATCATGTAC -3'
(R):5'- ACTTGACACAGGCATGACTG -3'

Sequencing Primer
(F):5'- TGTATCATGTACAAAGGTGGGAG -3'
(R):5'- CACAGGCATGACTGGGTGAC -3'
Posted On2017-02-10