Mutagenetix > Incidental Mutation

Incidental Mutation 'R0554:Prune2'

45424

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

038746-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0554 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 17125218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 2580 (C2580*)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000087689
AA Change: C2580*

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: C2580*

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226052

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	T	A	5: 145,045,371	Y255*	probably null	Het
1810024B03Rik	A	G	2: 127,187,276	M1T	probably null	Het
4930503L19Rik	T	C	18: 70,467,380	D386G	probably damaging	Het
Ace2	T	A	X: 164,175,951	N601K	probably benign	Het
Adam4	A	C	12: 81,421,424	I141R	probably damaging	Het
Adcy10	G	A	1: 165,513,130	G235S	probably benign	Het
Adcy5	G	A	16: 35,294,017	V997I	probably benign	Het
Aff2	T	G	X: 69,864,074	W1221G	possibly damaging	Het
Ankrd44	T	C	1: 54,763,758	N194D	probably benign	Het
Apba2	T	G	7: 64,745,780	L668R	probably damaging	Het
Asph	T	C	4: 9,604,581	D152G	probably damaging	Het
Bcl3	C	G	7: 19,820,066	V126L	probably benign	Het
Cd163	A	G	6: 124,312,660	T446A	probably benign	Het
Cd209g	C	T	8: 4,134,995		probably benign	Het
Cdadc1	A	T	14: 59,586,452	V197E	probably damaging	Het
CN725425	T	C	15: 91,260,763	C610R	possibly damaging	Het
Col6a2	A	G	10: 76,611,161		probably null	Het
Coro7	A	G	16: 4,632,257	L576P	possibly damaging	Het
Dgkb	T	A	12: 38,216,031	V503E	probably benign	Het
Dhx57	A	T	17: 80,260,236	L806*	probably null	Het
Dlec1	T	C	9: 119,115,002	V373A	probably benign	Het
Dnah11	G	T	12: 117,931,178	R3645S	probably benign	Het
Dnhd1	T	C	7: 105,694,395	S1649P	probably benign	Het
Draxin	T	G	4: 148,107,963	K297N	probably damaging	Het
Epha7	T	C	4: 28,951,401	S841P	probably damaging	Het
Esp8	T	G	17: 40,530,275	D142E	unknown	Het
F5	T	G	1: 164,179,449	V274G	probably damaging	Het
Fancc	T	C	13: 63,317,469	S475G	probably benign	Het
Fmo3	T	C	1: 162,954,332	N484S	probably benign	Het
Focad	T	C	4: 88,348,889	Y1046H	unknown	Het
Furin	C	T	7: 80,391,284	G602D	probably damaging	Het
Fut8	A	T	12: 77,364,970	I69L	probably benign	Het
Gm10436	T	C	12: 88,177,558	T162A	probably benign	Het
Gm4951	G	A	18: 60,245,417	R8H	probably benign	Het
Gnai3	A	G	3: 108,123,612	I78T	probably benign	Het
Gpr182	T	C	10: 127,751,071	I4V	probably benign	Het
Gpr63	T	C	4: 25,007,447	M57T	probably benign	Het
Grm1	T	A	10: 10,719,923	T654S	probably benign	Het
Gtf2h4	T	C	17: 35,668,639	T371A	probably benign	Het
Helq	T	C	5: 100,790,200	N460S	probably benign	Het
Hmcn1	T	C	1: 150,719,117	N1867S	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Inpp5j	A	G	11: 3,499,644	Y713H	probably damaging	Het
Ints6	A	T	14: 62,704,751	V511D	possibly damaging	Het
Itga4	A	G	2: 79,279,117	Y220C	probably damaging	Het
Itgav	T	G	2: 83,794,270	S735A	possibly damaging	Het
Kctd16	A	G	18: 40,258,439	I27V	probably benign	Het
Klhl6	T	C	16: 19,953,593	E334G	probably damaging	Het
Lrmp	G	A	6: 145,165,287	A237T	probably benign	Het
Ltbp1	T	A	17: 75,225,279	L116H	probably damaging	Het
Magohb	T	A	6: 131,285,697	H98L	probably benign	Het
Mgat2	A	G	12: 69,185,392	T247A	probably benign	Het
Mtif2	G	A	11: 29,533,398		probably null	Het
Myrfl	T	C	10: 116,828,973	E384G	probably damaging	Het
Nfam1	G	T	15: 83,033,209	R8S	probably benign	Het
Numa1	T	C	7: 101,995,524	S236P	possibly damaging	Het
Olfr1022	T	C	2: 85,869,519	F309S	probably benign	Het
Olfr310	A	T	7: 86,269,657	I44N	probably damaging	Het
Olfr317	T	C	11: 58,733,039	N42S	probably damaging	Het
Olfr777	T	C	10: 129,268,499	T275A	probably benign	Het
Orc4	C	T	2: 48,905,421	S431N	probably benign	Het
Pax2	T	C	19: 44,761,861	V129A	probably damaging	Het
Pcdhb15	A	G	18: 37,474,519	D268G	probably damaging	Het
Pdcd1	G	A	1: 94,039,382	R264C	probably damaging	Het
Pi15	T	A	1: 17,621,648	M187K	probably benign	Het
Plag1	C	T	4: 3,904,546	C215Y	probably damaging	Het
Plagl1	A	G	10: 13,127,182	T65A	probably benign	Het
Prss48	T	A	3: 86,000,921	Q18L	probably benign	Het
Rab40b	T	A	11: 121,359,606	Q74L	probably damaging	Het
Raf1	A	G	6: 115,623,530	I376T	probably benign	Het
Rbm46	A	T	3: 82,865,268	F186I	probably damaging	Het
Reps1	C	T	10: 18,123,119	T720M	possibly damaging	Het
Rgs22	A	G	15: 36,054,709	M649T	probably benign	Het
Rhot1	C	T	11: 80,243,438	R47*	probably null	Het
Rhox2f	A	G	X: 37,571,471	Y8C	possibly damaging	Het
Rnf17	A	G	14: 56,522,550	Y1604C	probably damaging	Het
Rnf40	T	C	7: 127,602,584	C943R	probably damaging	Het
Ropn1l	A	T	15: 31,451,149	M63K	probably benign	Het
Sbf2	C	A	7: 110,428,287	V501F	probably damaging	Het
Sh3bp1	T	A	15: 78,907,267	M354K	probably damaging	Het
Sipa1l3	T	C	7: 29,388,030	H590R	possibly damaging	Het
Slco6d1	T	A	1: 98,466,697	C369S	probably benign	Het
Sulf1	T	C	1: 12,805,194	Y143H	probably damaging	Het
Tiam2	A	T	17: 3,438,681	R755*	probably null	Het
Trim12c	C	A	7: 104,344,962	L228F	probably damaging	Het
Ttc23l	G	T	15: 10,530,657	Q290K	probably benign	Het
Uba3	T	C	6: 97,191,260		probably null	Het
Ugt1a10	A	G	1: 88,056,095	E205G	probably damaging	Het
Ugt3a2	T	A	15: 9,351,120	S72T	probably benign	Het
Upk3bl	C	T	5: 136,059,794	T113I	probably damaging	Het
Uspl1	T	A	5: 149,187,834	D20E	probably damaging	Het
Vmn2r19	G	A	6: 123,336,143	G724E	probably damaging	Het
Vmn2r63	T	A	7: 42,933,705	K29*	probably null	Het
Vwf	C	T	6: 125,642,781	A1474V	probably benign	Het
Xpc	C	T	6: 91,491,226	A860T	probably benign	Het
Zfp462	A	G	4: 55,013,689	H737R	probably damaging	Het
Zfp536	T	C	7: 37,480,819	D787G	probably damaging	Het
Zfp692	A	G	11: 58,314,227	H434R	probably damaging	Het
Zp1	C	A	19: 10,920,562	C5F	probably benign	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCATCAGGTACTAGCTGTGGAC -3'
(R):5'- GATTGGCTGCTCAAACCAGCAAC -3'

Sequencing Primer
(F):5'- CAGGTACTAGCTGTGGACTACATC -3'
(R):5'- AGTTCTACCAGGAGACTCAGGC -3'

Posted On

2013-06-11