Incidental Mutation 'R5867:Tfrc'
ID454248
Institutional Source Beutler Lab
Gene Symbol Tfrc
Ensembl Gene ENSMUSG00000022797
Gene Nametransferrin receptor
SynonymsMtvr-1, E430033M20Rik, Mtvr1, Trfr, 2610028K12Rik, p90, TfR1, CD71
MMRRC Submission 043233-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5867 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32608920-32632794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32620412 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 365 (C365S)
Ref Sequence ENSEMBL: ENSMUSP00000023486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023486] [ENSMUST00000120680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023486
AA Change: C365S

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023486
Gene: ENSMUSG00000022797
AA Change: C365S

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 229 348 1.1e-12 PFAM
Pfam:Peptidase_M28 390 597 1e-13 PFAM
Pfam:TFR_dimer 640 753 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120680
AA Change: C365S

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113028
Gene: ENSMUSG00000022797
AA Change: C365S

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 225 349 9.2e-11 PFAM
Pfam:Peptidase_M28 403 502 3.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231912
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface receptor necessary for cellular iron uptake by the process of receptor-mediated endocytosis. This receptor is required for erythropoiesis and neurologic development. Mice that are deficient in this receptor show impaired erythroid development and abnormal iron homeostasis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant embryos do not survive past E12.5, exhibiting anemia, hydrops fetalis, and neurological defects. Haploinsufficiency results in abnromal erythrocytes and tissue iron deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,052 V2900A probably damaging Het
Akip1 A G 7: 109,707,477 H127R probably benign Het
Alad A T 4: 62,512,966 Y56N probably damaging Het
Aldoart1 T A 4: 72,852,533 M13L probably benign Het
Ap1g1 C T 8: 109,818,982 A89V probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Cd209b T C 8: 3,924,246 I89V possibly damaging Het
Cd36 T C 5: 17,785,735 K469R probably benign Het
Cdh7 T A 1: 110,048,851 I82N probably damaging Het
Clmn G T 12: 104,781,755 P511H probably damaging Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Cyp2a5 T C 7: 26,842,958 F462L probably benign Het
Dclk2 A G 3: 86,791,859 *709Q probably null Het
Drd1 T C 13: 54,054,163 T4A probably benign Het
Ephb2 C T 4: 136,675,422 V513I possibly damaging Het
Fam43a T A 16: 30,601,459 V287E probably benign Het
Gm5134 A G 10: 76,008,616 E602G probably benign Het
Gtsf2 C T 15: 103,439,636 G149E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhl6 T C 16: 19,982,820 T62A probably benign Het
Lamb1 T A 12: 31,298,955 I662N possibly damaging Het
Lmod3 A G 6: 97,248,002 V286A probably damaging Het
Mefv T C 16: 3,715,933 D158G probably damaging Het
Mff T C 1: 82,750,606 probably null Het
Mfsd6l G T 11: 68,557,210 V296L possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Olfr1033 A G 2: 86,041,451 I45M probably benign Het
Pdk4 T A 6: 5,487,452 H266L probably benign Het
Pdrg1 T C 2: 153,014,055 N40D probably damaging Het
Pi4k2a T C 19: 42,105,485 probably null Het
Pkd1l2 T A 8: 117,055,011 D765V probably damaging Het
Pspc1 A T 14: 56,762,041 probably null Het
Ptprm T C 17: 67,045,981 probably null Het
Spata31d1d T C 13: 59,727,240 K827R possibly damaging Het
Srebf2 T A 15: 82,169,786 F46Y probably damaging Het
Ttc7 A G 17: 87,322,472 H294R possibly damaging Het
Ubr7 T A 12: 102,761,494 Y92N probably damaging Het
Vmn1r42 A C 6: 89,844,779 Y269* probably null Het
Vmn2r1 A G 3: 64,104,569 E617G probably benign Het
Vps13c A G 9: 67,982,622 probably null Het
Vps50 T C 6: 3,536,965 L312P probably damaging Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zcchc3 A G 2: 152,414,524 F85S probably damaging Het
Zfhx3 T C 8: 108,793,446 L400P probably damaging Het
Other mutations in Tfrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Tfrc APN 16 32624828 critical splice donor site probably null
IGL01553:Tfrc APN 16 32628585 missense probably benign 0.07
IGL01667:Tfrc APN 16 32624443 unclassified probably benign
IGL01761:Tfrc APN 16 32628551 missense probably damaging 1.00
IGL02085:Tfrc APN 16 32621186 missense probably benign 0.14
IGL02093:Tfrc APN 16 32630194 missense probably benign 0.06
IGL02401:Tfrc APN 16 32617181 missense probably damaging 1.00
IGL02548:Tfrc APN 16 32624822 nonsense probably null
IGL02715:Tfrc APN 16 32624371 missense probably benign
IGL03157:Tfrc APN 16 32620405 missense probably benign 0.00
IGL03242:Tfrc APN 16 32630112 missense probably damaging 1.00
IGL03410:Tfrc APN 16 32624831 splice site probably null
R0034:Tfrc UTSW 16 32615396 critical splice donor site probably null
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0508:Tfrc UTSW 16 32630179 missense probably damaging 1.00
R1474:Tfrc UTSW 16 32626649 missense probably damaging 0.99
R1613:Tfrc UTSW 16 32623375 missense probably damaging 1.00
R1694:Tfrc UTSW 16 32614625 missense probably damaging 0.99
R2430:Tfrc UTSW 16 32626711 missense probably damaging 1.00
R3807:Tfrc UTSW 16 32616826 missense possibly damaging 0.47
R4613:Tfrc UTSW 16 32618657 missense probably damaging 1.00
R4661:Tfrc UTSW 16 32630151 missense probably damaging 0.99
R4974:Tfrc UTSW 16 32618279 missense probably damaging 0.99
R5138:Tfrc UTSW 16 32615209 nonsense probably null
R5668:Tfrc UTSW 16 32623376 missense probably damaging 1.00
R5942:Tfrc UTSW 16 32626715 missense possibly damaging 0.65
R6185:Tfrc UTSW 16 32618272 missense probably benign 0.19
R6417:Tfrc UTSW 16 32630239 missense probably damaging 0.99
R7453:Tfrc UTSW 16 32619049 missense probably damaging 1.00
R7559:Tfrc UTSW 16 32621417 intron probably null
R7791:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7792:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7793:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7830:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7832:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7915:Tfrc UTSW 16 32619167 missense probably benign 0.00
R8055:Tfrc UTSW 16 32618656 missense probably benign 0.24
R8215:Tfrc UTSW 16 32625030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGAAGCACTGAATGACTCTTACC -3'
(R):5'- GCCAAGCTAGCATCCTTCTC -3'

Sequencing Primer
(F):5'- CTGAGAAATATCAGGCAGTAGTAGG -3'
(R):5'- CCTTCCTGCACTAGACCTATCTACAG -3'
Posted On2017-02-10