Incidental Mutation 'R5867:Ptprm'
ID454249
Institutional Source Beutler Lab
Gene Symbol Ptprm
Ensembl Gene ENSMUSG00000033278
Gene Nameprotein tyrosine phosphatase, receptor type, M
SynonymsRPTPmu
MMRRC Submission 043233-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5867 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location66666947-67354457 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 67045981 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091] [ENSMUST00000224862]
Predicted Effect probably null
Transcript: ENSMUST00000037974
SMART Domains Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
MAM 22 184 2.81e-73 SMART
IG 191 279 2.1e-6 SMART
FN3 281 364 6.35e-4 SMART
FN3 380 468 2.81e-5 SMART
FN3 482 572 3.7e-5 SMART
transmembrane domain 743 764 N/A INTRINSIC
low complexity region 765 774 N/A INTRINSIC
PTPc 899 1156 5.26e-135 SMART
PTPc 1185 1450 9.46e-96 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223982
Predicted Effect probably null
Transcript: ENSMUST00000224091
Predicted Effect probably null
Transcript: ENSMUST00000224862
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,052 V2900A probably damaging Het
Akip1 A G 7: 109,707,477 H127R probably benign Het
Alad A T 4: 62,512,966 Y56N probably damaging Het
Aldoart1 T A 4: 72,852,533 M13L probably benign Het
Ap1g1 C T 8: 109,818,982 A89V probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Cd209b T C 8: 3,924,246 I89V possibly damaging Het
Cd36 T C 5: 17,785,735 K469R probably benign Het
Cdh7 T A 1: 110,048,851 I82N probably damaging Het
Clmn G T 12: 104,781,755 P511H probably damaging Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Cyp2a5 T C 7: 26,842,958 F462L probably benign Het
Dclk2 A G 3: 86,791,859 *709Q probably null Het
Drd1 T C 13: 54,054,163 T4A probably benign Het
Ephb2 C T 4: 136,675,422 V513I possibly damaging Het
Fam43a T A 16: 30,601,459 V287E probably benign Het
Gm5134 A G 10: 76,008,616 E602G probably benign Het
Gtsf2 C T 15: 103,439,636 G149E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhl6 T C 16: 19,982,820 T62A probably benign Het
Lamb1 T A 12: 31,298,955 I662N possibly damaging Het
Lmod3 A G 6: 97,248,002 V286A probably damaging Het
Mefv T C 16: 3,715,933 D158G probably damaging Het
Mff T C 1: 82,750,606 probably null Het
Mfsd6l G T 11: 68,557,210 V296L possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Olfr1033 A G 2: 86,041,451 I45M probably benign Het
Pdk4 T A 6: 5,487,452 H266L probably benign Het
Pdrg1 T C 2: 153,014,055 N40D probably damaging Het
Pi4k2a T C 19: 42,105,485 probably null Het
Pkd1l2 T A 8: 117,055,011 D765V probably damaging Het
Pspc1 A T 14: 56,762,041 probably null Het
Spata31d1d T C 13: 59,727,240 K827R possibly damaging Het
Srebf2 T A 15: 82,169,786 F46Y probably damaging Het
Tfrc T A 16: 32,620,412 C365S possibly damaging Het
Ttc7 A G 17: 87,322,472 H294R possibly damaging Het
Ubr7 T A 12: 102,761,494 Y92N probably damaging Het
Vmn1r42 A C 6: 89,844,779 Y269* probably null Het
Vmn2r1 A G 3: 64,104,569 E617G probably benign Het
Vps13c A G 9: 67,982,622 probably null Het
Vps50 T C 6: 3,536,965 L312P probably damaging Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zcchc3 A G 2: 152,414,524 F85S probably damaging Het
Zfhx3 T C 8: 108,793,446 L400P probably damaging Het
Other mutations in Ptprm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Ptprm APN 17 66817972 missense probably damaging 1.00
IGL01128:Ptprm APN 17 67042101 missense probably damaging 1.00
IGL01509:Ptprm APN 17 66762213 missense possibly damaging 0.95
IGL01785:Ptprm APN 17 66685623 missense probably damaging 1.00
IGL01912:Ptprm APN 17 67046118 missense probably benign 0.13
IGL01929:Ptprm APN 17 66690549 missense probably damaging 1.00
IGL01937:Ptprm APN 17 67046163 splice site probably benign
IGL01939:Ptprm APN 17 67063163 splice site probably benign
IGL02053:Ptprm APN 17 66693841 missense probably damaging 1.00
IGL02203:Ptprm APN 17 66953123 missense probably damaging 1.00
IGL02468:Ptprm APN 17 66814509 missense probably benign 0.02
IGL02500:Ptprm APN 17 66920048 missense probably damaging 0.99
IGL02542:Ptprm APN 17 66920150 missense probably benign
Becalming UTSW 17 66944332 splice site probably null
Pacifying UTSW 17 66683408 missense possibly damaging 0.74
R0674:Ptprm UTSW 17 67191341 missense possibly damaging 0.52
R0709:Ptprm UTSW 17 66944332 splice site probably null
R1054:Ptprm UTSW 17 67042318 missense probably damaging 1.00
R1522:Ptprm UTSW 17 66693871 missense possibly damaging 0.91
R1561:Ptprm UTSW 17 66940541 missense probably damaging 1.00
R1726:Ptprm UTSW 17 67042327 missense probably damaging 1.00
R1744:Ptprm UTSW 17 66689366 missense probably damaging 1.00
R1873:Ptprm UTSW 17 66688355 missense probably damaging 1.00
R1951:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1952:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1953:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1993:Ptprm UTSW 17 66747160 missense probably damaging 1.00
R2017:Ptprm UTSW 17 66957153 intron probably null
R2266:Ptprm UTSW 17 66725851 splice site probably null
R2417:Ptprm UTSW 17 66944326 missense probably damaging 0.97
R2511:Ptprm UTSW 17 66693778 missense probably damaging 1.00
R3726:Ptprm UTSW 17 66956860 missense possibly damaging 0.91
R3824:Ptprm UTSW 17 66809575 missense probably benign 0.40
R4057:Ptprm UTSW 17 67075663 missense possibly damaging 0.93
R4113:Ptprm UTSW 17 66725813 missense probably damaging 1.00
R4559:Ptprm UTSW 17 66683408 missense possibly damaging 0.74
R4598:Ptprm UTSW 17 67095497 missense probably benign 0.00
R4742:Ptprm UTSW 17 66744751 nonsense probably null
R4974:Ptprm UTSW 17 66678067 missense probably benign 0.01
R5157:Ptprm UTSW 17 66957097 missense probably benign 0.09
R5433:Ptprm UTSW 17 66693473 missense probably damaging 1.00
R5509:Ptprm UTSW 17 66689358 missense probably damaging 1.00
R5586:Ptprm UTSW 17 66920196 missense probably damaging 1.00
R5820:Ptprm UTSW 17 66689465 missense probably damaging 1.00
R6044:Ptprm UTSW 17 66693862 missense probably damaging 1.00
R6229:Ptprm UTSW 17 66688300 missense probably damaging 1.00
R6615:Ptprm UTSW 17 67353956 critical splice donor site probably null
R6969:Ptprm UTSW 17 66912418 missense possibly damaging 0.63
R7135:Ptprm UTSW 17 66944288 missense possibly damaging 0.93
R7161:Ptprm UTSW 17 66809627 missense probably benign 0.21
R7410:Ptprm UTSW 17 66693566 missense probably damaging 0.99
R7476:Ptprm UTSW 17 66725791 missense probably benign 0.01
R7789:Ptprm UTSW 17 67095539 missense probably damaging 1.00
R8027:Ptprm UTSW 17 66944205 missense probably damaging 1.00
R8089:Ptprm UTSW 17 66683488 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CGGAAGCATTGCTCACATG -3'
(R):5'- ATGACAGCTGACATTGCCCC -3'

Sequencing Primer
(F):5'- GGCAGACAGGATAAGTTTG -3'
(R):5'- TCACTGATACAGGGAATTGATGTCCG -3'
Posted On2017-02-10