Incidental Mutation 'R5868:Bpifa1'
ID454259
Institutional Source Beutler Lab
Gene Symbol Bpifa1
Ensembl Gene ENSMUSG00000027483
Gene NameBPI fold containing family A, member 1
SynonymsSPLUNC1, Plunc
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5868 (G1)
Quality Score85
Status Validated
Chromosome2
Chromosomal Location154142880-154149219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154143876 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 37 (N37S)
Ref Sequence ENSEMBL: ENSMUSP00000028985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028985]
Predicted Effect unknown
Transcript: ENSMUST00000028985
AA Change: N37S
SMART Domains Protein: ENSMUSP00000028985
Gene: ENSMUSG00000027483
AA Change: N37S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LBP_BPI_CETP 83 256 2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144665
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of murine plunc, and like the mouse gene, is specifically expressed in the upper airways and nasopharyngeal regions. The encoded antimicrobial protein displays antibacterial activity against Gram-negative bacteria. It is thought to be involved in inflammatory responses to irritants in the upper airways and may also serve as a potential molecular marker for detection of micrometastasis in non-small-cell lung cancer. Multiple transcript variants resulting from alternative splicing in the 3' UTR have been detected, but the full-length nature of only three are known. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit increased susceptiblity to Mycoplasma pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Bpifa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Bpifa1 APN 2 154144000 missense probably benign 0.02
IGL03065:Bpifa1 APN 2 154147642 missense probably damaging 1.00
R0226:Bpifa1 UTSW 2 154146057 missense probably benign 0.03
R1946:Bpifa1 UTSW 2 154145634 missense probably damaging 1.00
R1986:Bpifa1 UTSW 2 154144336 missense probably damaging 1.00
R5608:Bpifa1 UTSW 2 154147575 intron probably benign
R6122:Bpifa1 UTSW 2 154143972 missense probably benign 0.11
R6297:Bpifa1 UTSW 2 154144260 missense probably benign 0.01
R6315:Bpifa1 UTSW 2 154146076 missense possibly damaging 0.48
R6965:Bpifa1 UTSW 2 154145661 missense probably damaging 1.00
X0017:Bpifa1 UTSW 2 154146151 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GAGATTCCTCTGATAGCTGTACC -3'
(R):5'- TGCCTTCCTGGTATTGCGAG -3'

Sequencing Primer
(F):5'- CCTCTGATAGCTGTACCATAGAG -3'
(R):5'- TGCGAGATTGGATATACTCAAGCAC -3'
Posted On2017-02-10